Nuclear Factor-B Activity in -Cells Is Required for Glucose-Stimulated Insulin Secretion
【关键词】 Glucose-Stimulated
the Ume Center for Molecular Medicine, University of Ume, Ume, Sweden
ABSTRACT
Glucose-stimulated insulin secretion (GSIS) in pancreatic -cells depends on coordinated glucose uptake, oxidative metabolism, and Ca2+-triggered insulin exocytosis. Impaired GSIS is a hallmark of type 2 diabetes. However, at present we know very little about the molecular mechanisms that induce and maintain the expression of genes required for GSIS in -cells. The transcription factor nuclear factor-B (NF-B) is activated by an increase in intracellular Ca2+ in -cells. Here, we show that attenuation of NF-B activation in -cells generates mice with impaired GSIS, and that the -cells show perturbed expression of genes required for glucose uptake, oxidative metabolism, and insulin exocytosis. Thus, NF-B appears to be part of a positive regulatory circuit that maintains GSIS in pancreatic -cells.
The mature -cell responds to elevated glucose levels by secreting insulin in a tightly controlled manner. In pancreatic -cells, the low-affinity glucose transporter type 2 (GLUT2) mediates uptake of glucose, which is then phosphorylated by the glycolytic enzyme glucokinase. The subsequent oxidative metabolism of glucose leads to a rise in the cytosolic ATP-to-ADP ratio, which provokes the closure of ATP-sensitive K+ (KATP) channels. The closure of KATP channels leads to membrane depolarization, which triggers the opening of voltage-gated Ca2+ channels. The resulting influx and rise in intracellular levels of Ca2+ then triggers first- and second-phase insulin release (1). This physiological response of -cells to elevated blood glucose levels is critical for maintenance of normoglycemia and is an acquired property. Fetal -cells respond poorly to glucose stimuli but progressively attain an adequate response to glucose after birth (2,3). During the development of type 2 diabetes, glucose-stimulated insulin secretion (GSIS) is gradually impaired and loss of first-phase insulin secretion is evident already at the early pre-diabetic stage (4,5). Many type 2 diabetic patients ultimately develop significant -cell failure, highlighting the role of adequate -cell function for maintenance of normoglycemia.
Activation of the nuclear factor-B (NF-B)/Rel family of transcription factors is mediated by the phosphorylation and subsequent degradation of inhibitor B (IB), which renders NF-B free to enter the nucleus (6). NF-B activity is induced in response to a variety of stimuli, and recently it has been shown that NF-B is activated by physiologically provoked Ca2+ influx in both neurons (7) and insulinoma cells (8). These findings suggest that NF-B might be involved in transducing Ca2+ signals from the cytoplasm to the nucleus in response to physiological cues. In -cells, glucose uptake and subsequent metabolism lead to Ca2+ influx, which is critical for regulated insulin secretion, suggesting a potential link between GSIS and the activation of NF-B. To investigate whether NF-B activity in -cells in turn is required for -cell function and GSIS, we perturbed the activation of NF-B in insulinoma cells and in transgenic mice.
RESEARCH DESIGN AND METHODS
Generation and genotyping of transgenic mice.
IBM cDNA (Clontech, Palo Alto, CA) was cloned after the Ipf1/Pdxl promoter (9) and followed by a SV40 polyA site. Transgenic mice were generated by pronuclear injection of the purified fragment (1.8 ng/ml) into F2 hybrid oocytes from B6/CBA parents (M&B) (10). The genotype was determined by PCR analysis of genomic DNA extracted from tail biopsies using primers insulin promoter factor (IPF) 15'-3(GGGAAGAGGAGATGTAGACTT), IKBAM-R(GGTCAGTGCCTTTTCTTC), and IPF1-AR(GAGCTGAGCTGGAAGGT). Ipf1/IBM integration was analyzed by genomic Southern blot using a probe complementary to the Ipf1 promoter. Four independent transgenic lines showed blunted GSIS, and two of these were selected for further analysis.
NF-B reporter assay and cultivation of isolated islets.
MIN6 cells were transfected with pNF-Luc (Promega), pMT21/lacZ, Ipf1/IBM, or empty vector using Lipofectamin according to the manufacturers recommendations. The cells were incubated overnight in Dulbecco’s modified Eagle’s medium, 5.5 mmol/l glucose, and 10% fetal bovine serum (FBS). The cells were then stimulated for 2 h with pyrollidine dithiocarbamate (PDTC; 100 eol/l), and luciferase activity was measured using a luciferase assay system (Promega). All values were normalized to -galactosidase activity from cotransfected pMT21/lacZ. Islets were isolated and recovered overnight in RPMI 1640 with 10% FBS (11) before experiments. For insulin secretion measurement, islets were equilibrated 1 h in 1 x HEPES medium (3.3 mmol/l glucose) and transferred to 1 x HEPES medium containing 3.3 or 20 mmol/l glucose. PDTC treatment was started during ON recovery and continued throughout the experiment. The supernatant and islets were analyzed for insulin content using enzyme-linked immunosorbent assay (see below). For cytokine stimulation, islets were stimulated for 8 h with interleukin-1 (1 ng/ml) and -interferon (1 e/ml) in RPMI 1640 with 10% FBS.
Immunohistochemistry and apoptosis analysis.
Immunohistochemistry was performed essentially as described (12) on neonatal and adult (aged 10eC12 weeks) B6/CBA mice pancreas. Primary antibodies used were rabbit anti-IB (sc-847; Santa Cruz Biotechnology), rabbit anti-IPF1/pancreatic duodenal homeobox 1 (PDX1) (13), guinea pig anti-insulin (Linco), guinea pig anti-glucagon (Linco), rabbit anti-glucagon (Linco), rat anti-somatostatin (Bender MedSystems), rabbit anti-GLUT2 (AB1342; Chemicon), rabbit antieCsulfonylurea receptor 1 (SUR1) (14), and rabbit anti-Kir6.2 (15). The following secondary antibodies were used: Cy3-conjugated goat anti-rabbit IgG, dichlorotriazine fluoresceineCconjugated goat antieCguinea pig IgG, and Cy3-conjugated streptavidin (The Jackson Laboratory). Apoptosis was detected by terminal deoxynucleotidyl transferaseeCmediated dUTP nick-end labeling (TUNEL) assay (Roche Diagnostics) or by staining for the apoptotic markereCcleaved caspase 3 (Cell Signaling Technology).
Quantification of endocrine cell types.
Neonatal pancreas from wild-type (n = 4) and NI (n = 3) mice were sectioned. Every 10th section was selected for analysis. The different endocrine cell types were detected with antibodies against insulin, glucagon, somatostatin, and pancreatic polypeptide. Isl1 antibodies (16) were used to label all endocrine cells. The ratio between the total area of immunoreactivity and the total area of 4',6 diamidino-2-phenylindole staining was calculated by image analysis software (Image Pro Plus; Media Cybernetics) and used to evaluate the abundance of the different endocrine cell types.
In vivo glucose and insulin measurements.
Overnight-fasted (GSIS test and arginine test) or nonfasted mice were injected intraperitoneally with the following substances (dose/kg body wt): glucose (1 g/kg), recombinant human insulin (0.75 units/kg; Novo Nordisk), glybenclamide (5 mg/kg G-0639; Sigma), carbachol (0.16 eol/kg C-4382; Sigma), and L-arginine (1 g/kg A-5131; Sigma). Blood samples were obtained from the tail vein. Blood glucose levels were measured using a Glucometer Elite (Bayer). Total pancreatic insulin was extracted using acid ethanol (75% ethanol, 0.2 mol/l HCl) and measured using a sensitive rat insulin radioimmunoassay kit (Linco). Total pancreatic protein concentration was determined using a protein assay (Bio-Rad). Serum insulin levels were measured using enzyme-linked immunosorbent assay (Crystal Chem). Statistical significance was calculated using Student’s t test.
Quantification of mRNA and protein expression levels.
Cytoplasmic protein extract was prepared from isolated islets and analyzed using Western blot. Endogenous IB and mutant IBM were detected using anti-IB (sc-847; Santa Cruz Biotechnology) and Supersignal West Pico chemiluminescent substrate (Pierce) and quantified using Imagequant software. NI lines that expressed high levels of IBM were chosen for further analysis. cDNA was prepared from total RNA prepared from freshly isolated islets (Fig. 5) or cultivated islets (Fig. 2) essentially as described (9). Real-time PCR analysis was performed using an ABI Prism 7000 sequence detection system and SYBR Green PCR Master Mix (ABI) according to the manufacturer’s recommendations. Expression of the 60S acidic ribosomal protein P0 (Arbp) (Figs. 2 and 5) and -2-microglobulin (b2M) (Fig. 5) was used to normalize expression levels.
RESULTS
Attenuation of NF-B activation in vitro perturbs insulin secretion.
A commonly used, specific, and effective strategy to suppress NF-B activation is to express a dominant active mutant of IB, IBM, which acts by sequestering NF-B dimers in an inactive cytoplasmatic complex (17,18). In addition, the antioxidant PDTC has been widely used to inhibit NF-B activity in cells (19), although the mechanism of action of this agent remains poorly understood. NF-B activity in MIN6 insulinoma cells was monitored by transfection of a luciferase reporter driven by five tandem NF-B consensus binding sites. The expression of the NF-B reporter construct was efficiently reduced in MIN6 cells when cotransfected with an IBM construct, driven by the Ipf1 promoter (Ipf1/IBM) (Fig. 1A). Similarly, the chemical NF-B inhibitor PDTC also impaired NF-B transcriptional activity in MIN6 cells (Fig. 1A). Thus, both experimental approaches inhibited NF-B activity in MIN6 insulinoma cells.
To test whether attenuation of NF-B activity affects GSIS, we monitored the release of insulin in isolated islets treated with PDTC. Islets elicited an almost fivefold increase in secreted insulin when exposed to high glucose. In contrast, high glucose failed to stimulate insulin secretion from islets exposed to PDTC (Fig. 1B), suggesting that NF-B activity may be required in isolated islet cells for efficient GSIS.
In vivo attenuation of NF-B activity leads to impaired GSIS and diabetes.
Although PDTC is a known and widely used inhibitor of NF-B, we cannot exclude that it also may affect other, NF-BeCunrelated targets. Thus, to selectively inhibit NF-B and elucidate whether NF-B activity is required for -cell function and insulin secretion in vivo, we next generated transgenic mice expressing the dominant-active mutant of IB, IBM, also known as the NF-B super-repressor, under the control of the Ipf1 promoter. The resulting Ipf1/IBM transgenic mice are hereafter denoted NI (for NF-B inhibition in -cells). To confirm that IBM also suppresses NF-B activation when expressed in the islets of the resulting NI mice, we analyzed the expression of cytokine-induced and NF-BeCdependent target genes in wild-type and transgenic islets after exposure to cytokines. Islets isolated from NI mice showed a 40eC70% reduction of the known NF-BeCdependent target genes iNOS, MnSOD, MCP-1, and IB (20eC23) after stimulation with interleukin-1 and -interferon (Fig. 2E). These data provide evidence that expression of IBM impairs NF-B activity not only in insulinoma cells but also in -cells of NI mice. A comparison of IBM expression in freshly isolated transgenic islets compared with in vitroeCcultivated transgenic islets showed that the expression of IBM was reduced by 95% on in vitro cultivation (Fig. 2E), suggesting that the attenuation of NF-B activity is more efficient in vivo.
NI mice were lean and fertile but showed elevated fasted and nonfasted blood glucose levels (i.e., mild diabetes) when compared with littermates (Table 1). To further examine the ability of the NI mice to control blood glucose levels, they were challenged with a pulse of exogenous glucose. Blood glucose in control mice typically peaked after 30 min and had returned to normal levels after 90 min. Mice derived from founder A, expressing high levels of IBM (Figs. 2AeCD), failed to reduce blood glucose levels, and the blood glucose levels were still elevated after 180 min (Fig. 3). Mice derived from founder C, which expressed intermediate levels of IBM (Figs. 2C and D), also showed impaired glucose tolerance, although the blood glucose levels in these mice had declined by 180 min (Fig. 3). These results provide evidence that attenuation of NF-B activation in -cells in vivo leads to impaired glucose tolerance and mild diabetes.
To test whether the impaired glucose homeostasis in NI mice reflected perturbations in insulin secretion, we monitored insulin levels in NI mice at nonfasted conditions as well as serum insulin levels in response to glucose challenge. NF-B activity is sensitive to oxidative, chemical, and physical stress (6), and in vitro cultivation of isolated transgenic islets also resulted in severely reduced expression of IBM (Fig. 2E). Thus, to avoid the stress associated with islet isolation and in vitro cultivation, and to ensure high-level expression of IBM, all analyses of insulin secretion were performed in vivo. Despite elevated glucose levels, serum insulin levels were significantly lower in nonfasted NI mice compared with control littermates (Table 1). Moreover, NI mice lacked both first- and second-phase insulin release in response to glucose challenge, whereas serum levels increased rapidly after glucose injection and peaked after 15 min in control mice (Figs. 4A and data not shown). Together, these results demonstrate that NI mice fail to secrete insulin in response to elevated blood glucose levels.
-Cell mass and insulin sensitivity are virtually normal in NI mice.
To exclude the possibility that the blunted GSIS observed in NI mice reflected a low number of -cells, we determined -cell number and total pancreatic insulin content. The NI mice exhibited a seemingly normally developed pancreas with islets (data not shown), and they showed a 25% reduction in the total number of endocrine cells as well as in total pancreatic insulin content when compared with control littermates (n = 7, P = 0.04). Conflicting reports suggest a role for NF-B in both mediating and preventing cytokine-induced -cell death (21eC24). The observed 25% decrease in endocrine cell number in the NI mice could thus reflect an increase in apoptosis, which would support an antiapoptotic role for NF-B in pancreatic -cells. No increased cell apoptosis was, however, observed in neonatal or adult pancreata from NI mice when performing TUNEL assay or by staining for the apoptotic marker caspase 3 (data not shown), suggesting that the slight decrease in the number of endocrine cells in NI mice is not caused by increased apoptosis. Moreover, Bcl-2 mRNA was upregulated in isolated islets from NI mice, which would rather support a proapoptotic role of NF-B in pancreatic -cells (Fig. 5). The NI mice responded normally to exogenous insulin (Fig. 6), excluding both low numbers of -cells and insulin resistance as major causes of the glucose intolerance and impaired GSIS. Collectively, these results provide evidence that attenuated NF-B activation in -cells severely perturbs GSIS but not -cell generation.
Perturbed expression of genes required for glucose uptake and oxidative metabolism in -cells of NI mice.
Uptake of glucose into the -cell, the first step in GSIS, is mediated by GLUT2, and decreased GLUT2 expression has been observed in a variety of diabetic animal models (25). Glut2 mutant mice display hyperglycemia, glucose intolerance, and a lack of first-phase insulin secretion in response to glucose (26). To assess whether perturbed GLUT2 expression contributed to the blunted GSIS of the NI mice, we compared GLUT2 expression in -cells of the NI and wild-type mice at both the mRNA (Fig. 5) and protein (Fig. 7) level. Quantitative real-time PCR showed that the level of Glut2 expression was reduced by 80% in islets of adult NI compared with control mice (Fig. 5). Consequently, -cells of both adult and neonatal NI mice failed to express high levels of GLUT2 protein (Fig. 7), providing evidence that suppression of NF-B activation rather than hyperglycemia impairs GLUT2 expression in these mice. Thus, NF-B activation is required for high-level GLUT2 expression in postnatal -cells.
The transcription factors IPF1/PDX1 and hepatocyte nuclear factor-1 (HNF-1) are also required for high-level expression of GLUT2 (27eC30) in -cells. To investigate whether the impaired Glut2 expression observed in the NI mice was the consequence of reduced expression of Ipf1/Pdx1 and/or HNF1-, we monitored the expression of Ipf1/Pdx1, HNF1-, and some of their proposed target genes (27eC30). The expression of Ipf1/Pdx1 and HNF1- and of the respective downstream genes fibroblast growth factor receptor 1c (FGFR1c) and prohormone convertase (PC1/3), as well as glucokinase, L-puryvate kinase (LPK), and mitochondrial 2-oxo-glutarate dehydrogenase (OGDH) appeared normal in the NI mice (Figs. 5 and data not shown), indicating that NF-B activity does not act upstream of Ipf1/Pdx1 and HNF-1 to ensure high-level Glut2 expression in postnatal -cells.
Glut2 mutant mice (26) lack first- but not second-phase GSIS. In contrast, the NI mice lacked both first- and second-phase insulin secretion (Figs. 4A and data not shown), indicating that the insulin secretory mechanism of the NI mice might also be perturbed downstream of GLUT2 expression and glucose uptake. Uncoupling protein-2 (UCP-2) impairs GSIS by uncoupling respiration from oxidative phosphorylation, which in turn leads to reduced ATP production (31,32). Overexpression of Ucp-2 in -cells blunts GSIS (31,32), whereas both Ucp-2+/eC and Ucp-2eC/eC mice show improved GSIS (32,33). However, the mechanism by which UCP-2 expression and/or activity is regulated remains largely unknown, although recent data suggest that superoxide can stimulate UCP-2 activity (34). Ucp-2 expression was increased by 60% in islets derived from NI mice when compared with control islets (Fig. 5), which is likely to impair the generation of ATP in the -cells of NI mice. Collectively, these results provide evidence that impaired NF-B activity leads, directly or indirectly, to increased Ucp-2 expression in -cells. Thus, attenuated NF-B activity leads to perturbed expression of key genes involved in both glucose uptake and ATP generation in -cells.
NI mice show a blunted response to secretagogues.
Apart from glucose, a variety of other substances, or secretagogues, can stimulate insulin secretion from -cells. Glybenclamide, a sulfonylurea drug, induces membrane depolarization and insulin secretion by directly blocking the SUR1/Kir6.2 KATP channel (35). Carbachol, a cholinergic agonist, enhances GSIS via the phospholipase C/protein kinase C signaling pathway and is suggested to increase the transport of insulin vesicles to the secretory site (1,36,37). These secretagogues depend, at least partly, on intact glucose metabolism for their ability to stimulate insulin secretion (36eC42). Both secretagogues effectively stimulated insulin secretion in control mice. In contrast, NI mice responded poorly to glybenclamide and carbachol (Figs. 4B and C), although immunohistochemical analysis revealed normal expression of the KATP channel components SUR1 and the Kir6.2 subunit (data not shown). Thus, the impaired secretory responses to glybenclamide and carbachol are likely to reflect perturbed glucose uptake and utilization caused by the aberrant expression of Glut2 and Ucp-2.
Arginine stimulates insulin secretion largely independent of glucose by directly depolarizing the -cell membrane, but it still depends on a fully functional pathway of insulin exocytosis (38,41eC43). Arginine administration to fasted control mice resulted in a rapid and transient increase in serum insulin levels between 0 and 10 min after injection. The NI mice also responded to arginine by secreting insulin, but the secretory response was slow, and insulin levels were still elevated after 20 min (Fig. 4D). The atypical kinetic pattern of insulin secretion suggests that in addition to glucose utilization, the insulin exocytosis process is perturbed in NI mice.
Perturbed expression of genes linked to exocytosis in NI mice.
The exact mechanism by which insulin exocytosis is regulated remains poorly defined; however, the Rab3 family of GTPases have been implicated in the control of insulin exocytosis (1). Studies in insulinoma cell lines implicate all Rab3 isoforms in nutrient-induced, but not basal, insulin secretion (44), and overexpression of both wild-type and mutant versions of the Rab3 proteins impaired Ca2+-triggered exocytosis in neuroendocrine cell lines (45). Interestingly, Rab3a mutant mice are glucose intolerant and show impaired insulin secretion in response to arginine. The level of expression of the Rab3C isoform (1,44) was consistently decreased by 80% in islets of NI mice (Fig. 5), and Rab3B was upregulated. No significant differences in the levels of expression of the Rab3A and D isoforms, or of the SNAP (soluble N-ethylmaleimideeCsensitive factor attachment protein) receptor Vamp-2 gene, which has also been implicated in insulin exocytosis (1), were observed in islets of control and NI mice (Fig. 5). Taken together, the altered kinetic response to arginine and the altered expression of Rab3B and Rab3C collectively suggest that insulin exocytosis is perturbed in -cells of the NI mice.
DISCUSSION
Glucose homeostasis in mammals critically depends on coordinated glucose uptake, oxidative metabolism, and insulin exocytosis in -cells. NF-B activity in -cells appears to be stimulated by a rise in intracellular Ca2+ (8). Our results provide evidence that suppression of NF-B activity in -cells leads to impaired GSIS and to perturbed expression of genes involved in glucose uptake, oxidative metabolism, and Ca2+ triggered exocytosis of insulin. Thus, taken together, these findings suggest that NF-B is part of a positive regulatory circuit that maintains GSIS in -cells.
Fetal -cells show an impaired insulin secretion in response to glucose as well as to insulin secretagogues like tolbutamide and arginine (2,3). The ability to respond to glucose and other secretagogues is significantly improved in -cells of newborns compared with late gestational fetuses, and then improves further with age to reach the full GSIS response displayed by adult -cells (2,3). The expression of GLUT2 correlates well with the acquirement of GSIS during -cell maturation. GLUT2 is expressed at low levels in fetal -cells, and the expression is then gradually increased in newborn and adult -cells (46eC48). The low-level expression of GLUT2 observed in neonatal NI mice, as compared with control littermates, suggests that NF-B activity is required during fetal development and/or at birth for -cell maturation.
Glut2 mutant mice display hyperglycemia, glucose intolerance, and a lack of first-phase insulin secretion in response to glucose (26). Patients diagnosed with Fanconi-Bickel syndrome, due to Glut2 mutations, have been reported to display diabetes, defective -cell glucose sensing, and inappropriately low insulin secretion (49), suggesting a conserved function for Glut2 in assuring normal glucose homeostasis in both mice and humans. GLUT2 is expressed at low levels in HNF1-eCdeficient mice (29,30), as well as in mice with impaired Ipf1/Pdx1 and FGFR1c activity in -cells (27,28)―mice that all develop diabetes. Apart from GLUT2, the expression of HNF1-, Ipf1/Pdx1, and FGFR1c signaling components, and several of their proposed target genes, was normal in NI mice, suggesting that NF-B does not act upstream of these genes. Nevertheless, the impaired expression of Glut2 in Ipf1/IBM mice leaves open the possibility that NF-B acts downstream of or in parallel with HNF1-, IPF1/PDX1, and FGFR1c signaling to ensure the acquisition and maintenance of high-level Glut2 expression. NF-B activation in response to Ca2+ influx appears to depend on mitogen-activated protein (MAP)/ERK (extracellular signal-related kinase) kinase (MEK)/MAP kinase (MAPK) (8) activity, and fibroblast growth factor signaling is known to activate the MEK/MAPK (50) pathway, raising the possibility that Ipf1/Pdx1 function, and hence FGFR1c signaling via MEK/MAPK, stimulates NF-B activation to assure high-level expression of Glut2 in pancreatic -cells.
The perturbed exocytosis of insulin displayed by NI mice in response to arginine may, at least in part, be explained by the downregulation of Rab3C and/or the modest upregulation of Rab3D. The exact role of Rab3 proteins in the insulin exocytotic process remains poorly defined, and neither Rab3C nor Rab3D mutant mice are available. However, Rab3A mutant mice are glucose intolerant and show a normal increase in serum insulin levels in response to a single dose of arginine, but they show a blunted response to a second consecutive arginine injection, indicating that the primary defect in Rab3AeC/eC mice is at the level of recruitment of insulin vesicles to the readily releasable pool (43). In contrast, NI mice show a slow secretory response to a single dose of arginine, and the initial rapid burst of insulin release is absent. Together, these data suggest that the -cells of NI mice can recruit insulin vesicles to the readily releasable pool, but that the final step of insulin exocytosis is perturbed. These data also suggest that despite a high degree of homology between the different Rab3 isoforms, they might be functionally different in pancreatic -cells.
The combined perturbations in Glut2, Ucp-2, and Rab3C and D expression will perturb -cell function at several different levels (glucose uptake, glucose metabolism, and insulin exocytosis), consequently leading to impaired GSIS. Impaired GSIS is a hallmark of type 2 diabetes (4,5), but the molecular mechanisms underlying the -cell defects remain largely unknown. Our data provide evidence that NF-B activation is an important step in the mechanism that ensures proper glucose-coupled stimulation of insulin secretion. Hence, the findings presented here might be relevant for our understanding of the insulin secretory defects displayed by -cells of type 2 diabetic patients. Whether attenuation of NF-B activity contributes to -cell dysfunction in humans, however, remains to be determined.
ACKNOWLEDGMENTS
This work was supported by grants from the Medical Faculty at Ume University (to S.N.), the Swedish Research Council, the Gran Gustafsson Foundation for Research in Natural Sciences and Medicine, the Swedish Diabetes Foundation, Wallenberg Consortium North, the Juvenile Diabetes Research Foundation, and the European Union Regional Fund, Objective 1 (to H.E.).
We thank the Ume Transgene Core Facility, C. Granberg, U. Valtersson, E. Plsson, and I. Berglund-Dahl for technical assistance; Lena Kvist, Bo Ahreen, and U. Dahl for helpful technical instructions and suggestions; members in our laboratory for helpful discussions; and Thomas Edlund for critical reading and comments.
FOOTNOTES
H.E. is a cofounder and shareholder of Betagenon, a biotechnology company.
FBS, fetal bovine serum; FGFR1c, fibroblast growth factor receptor 1c; GSIS, glucose-stimulated insulin secretion; HNF-1, hepatocyte nuclear factor-1; IB, inhibitor B; IPF, insulin promoter factor; KATP channel, ATP-sensitive K+ channel; MAP, mitogen-activated protein; MAPK, MAP kinase; MEK, MAP/ERK (extracellular signal-related kinase) kinase; NF-B, nuclear factor-B; PDTC, pyrollidine dithiocarbamate; PDX1, pancreatic duodenal homeobox 1; SUR1, sulfonylurea receptor 1; TUNEL, terminal deoxynucleotidyl transferaseeCmediated dUTP nick-end labeling; UCP, uncoupling protein
REFERENCES
Easom RA: Beta-granule transport and exocytosis. Semin Cell Dev Biol11 :253 eC266,2000
Espinosa de los M, Driscoll SG, Steinke J: Insulin release from isolated human fetal pancreatic islets. Science168 :1111 eC1112,1970
Heinze E, Steinke J: Insulin secretion during development: response of isolated pancreatic islets of fetal, newborn and adult rats to theophylline and arginine. Horm Metab Res4 :234 eC236,1972
Pratley RE, Weyer C: Progression from IGT to type 2 diabetes mellitus: the central role of impaired early insulin secretion. Curr Diab Rep2 :242 eC248,2002
Haffner SM, Miettinen H, Gaskill SP, Stern MP: Decreased insulin action and insulin secretion predict the development of impaired glucose tolerance. Diabetologia39 :1201 eC1207,1996
Li X, Stark GR: NFkappaB-dependent signaling pathways. Exp Hematol30 :285 eC296,2002
Meffert MK, Chang JM, Wiltgen BJ, Fanselow MS, Baltimore D: NF-kappa B functions in synaptic signaling and behavior. Nat Neurosci6 :1072 eC1078,2003
Bernal-Mizrachi E, Wen W, Shornick M, Permutt MA: Activation of nuclear factor-B by depolarization and Ca2+ influx in MIN6 insulinoma cells. Diabetes51 (Suppl. 3) :S484 eCS488,2002
Apelqvist A, Ahlgren U, Edlund H: Sonic hedgehog directs specialised mesoderm differentiation in the intestine and pancreas. Curr Biol7 :801 eC804,1997
Hogan B, Beddington R, Costantini F, Lacy E: Manipulating the Mouse Embryo. Plainview, NY, Cold Spring Harbour Laboratory Press,1994
Ahren B, Sauerberg P, Thomsen C: Increased insulin secretion and normalization of glucose tolerance by cholinergic agonism in high fat-fed mice. Am J Physiol277 :E93 eCE102,1999
Ahlgren U, Jonsson J, Edlund H: The morphogenesis of the pancreatic mesenchyme is uncoupled from that of the pancreatic epithelium in IPF1/PDX1-deficient mice. Development122 :1409 eC1416,1996
Ohlsson H, Karlsson K, Edlund T: IPF1, a homeodomain-containing transactivator of the insulin gene. Embo J12 :4251 eC4259,1993
Suzuki M, Fujikura K, Kotake K, Inagaki N, Seino S, Takata K: Immuno-localization of sulphonylurea receptor 1 in rat pancreas. Diabetologia42 :1204 eC1211,1999
Suzuki M, Fujikura K, Inagaki N, Seino S, Takata K: Localization of the ATP-sensitive K+ channel subunit Kir6.2 in mouse pancreas. Diabetes46 :1440 eC1444,1997
Thor S, Ericson J, Brannstrom T, Edlund T: The homeodomain LIM protein Isl-1 is expressed in subsets of neurons and endocrine cells in the adult rat. Neuron7 :881 eC889,1991
Brown K, Gerstberger S, Carlson L, Franzoso G, Siebenlist U: Control of I kappa B-alpha proteolysis by site-specific, signal-induced phosphorylation. Science267 :1485 eC1488,1995
Chen Z, Hagler J, Palombella VJ, Melandri F, Scherer D, Ballard D, Maniatis T: Signal-induced site-specific phosphorylation targets I kappa B alpha to the ubiquitin-proteasome pathway. Genes Dev9 :1586 eC1597,1995
Schreck R, Meier B, Mannel D, Droge W, Baeuerle P: Dithiocarbamates as potent inhibitors of nuclear factor kappa B activation in intact cells. J Exp Med175 :1181 eC1194,1992
Cardozo AK, Heimberg H, Heremans Y, Leeman R, Kutlu B, Kruhoffer M, Orntoft T, Eizirik DL: A comprehensive analysis of cytokine-induced and nuclear factor-kappa B-dependent genes in primary rat pancreatic beta-cells. J Biol Chem276 :48879 eC48886,2001
Heimberg H, Heremans Y, Jobin C, Leemans R, Cardozo AK, Darville M, Eizirik DL: Inhibition of cytokine-induced NF-B activation by adenovirus-mediated expression of a NF-B super-repressor prevents -cell apoptosis. Diabetes50 :2219 eC2224,2001
Baker MS, Chen X, Cao XC, Kaufman DB: Expression of a dominant negative inhibitor of NF-kappaB protects MIN6 beta-cells from cytokine-induced apoptosis. J Surg Res97 :117 eC122,2001
Park H, Ahn Y, Park CK, Chung HY, Park Y: Interleukin-6 protects MIN6 beta cells from cytokine-induced apoptosis. Ann N Y Acad Sci1005 :242 eC249,2003
Chang I, Kim S, Kim JY, Cho N, Kim YH, Kim HS, Lee MK, Kim KW, Lee MS: Nuclear factor B protects pancreatic -cells from tumor necrosis factor-eCmediated apoptosis. Diabetes52 :1169 eC1175,2003
Efrat S: Making sense of glucose sensing. Nat Genet17 :249 eC250,1997
Guillam MT, Hummler E, Schaerer E, Yeh JI, Birnbaum MJ, Beermann F, Schmidt A, Deriaz N, Thorens B, Wu JY: Early diabetes and abnormal postnatal pancreatic islet development in mice lacking Glut-2. Nat Genet17 :327 eC330,1997
Ahlgren U, Jonsson J, Jonsson L, Simu K, Edlund H: Beta-cell-specific inactivation of the mouse Ipf1/Pdx1 gene results in loss of the beta-cell phenotype and maturity onset diabetes. Genes Dev12 :1763 eC1768,1998
Hart AW, Baeza N, Apelqvist A, Edlund H: Attenuation of FGF signalling in mouse beta-cells leads to diabetes. Nature408 :864 eC868,2000
Wang H, Antinozzi PA, Hagenfeldt KA, Maechler P, Wollheim CB: Molecular targets of a human HNF1 alpha mutation responsible for pancreatic beta-cell dysfunction. Embo J19 :4257 eC4264,2000
Shih DQ, Screenan S, Munoz KN, Philipson L, Pontoglio M, Yaniv M, Polonsky KS, Stoffel M: Loss of HNF-1 function in mice leads to abnormal expression of genes involved in pancreatic islet development and metabolism. Diabetes50 :2472 eC2480,2001
Chan CB, MacDonald PE, Saleh MC, Johns DC, Marban E, Wheeler MB: Overexpression of uncoupling protein 2 inhibits glucose-stimulated insulin secretion from rat islets. Diabetes48 :1482 eC1486,1999
Zhang CY, Baffy G, Perret P, Krauss S, Peroni O, Grujic D, Hagen T, Vidal-Puig AJ, Boss O, Kim YB, Zheng XX, Wheeler MB, Shulman GI, Chan CB, Lowell BB: Uncoupling protein-2 negatively regulates insulin secretion and is a major link between obesity, beta cell dysfunction, and type 2 diabetes. Cell105 :745 eC755,2001
Saleh MC, Wheeler MB, Chan CB: Uncoupling protein-2: evidence for its function as a metabolic regulator. Diabetologia45 :174 eC187,2002
Krauss S, Zhang C-Y, Scorrano L, Dalgaard LT, St-Pierre J, Grey ST, Lowell BB: Superoxide-mediated activation of uncoupling protein 2 causes pancreatic {beta} cell dysfunction. J Clin Invest112 :1831 eC1842,2003
Huopio H, Shyng SL, Otonkoski T, Nichols CG: K(ATP) channels and insulin secretion disorders. Am J Physiol Endocrinol Metab283 :E207 eCE216,2002
Garcia MC, Hermans MP, Henquin JC: Glucose-, calcium- and concentration-dependence of acetylcholine stimulation of insulin release and ionic fluxes in mouse islets. Biochem J254 :211 eC218,1988
Guenifi A, Simonsson E, Karlsson S, Ahren B, Abdel-Halim SM: Carbachol restores insulin release in diabetic GK rat islets by mechanisms largely involving hydrolysis of diacylglycerol and direct interaction with the exocytotic machinery. Pancreas22 :164 eC171,2001
Thams P, Capito K: L-arginine stimulation of glucose-induced insulin secretion through membrane depolarization and independent of nitric oxide. Eur J Endocrinol140 :87 eC93,1999
Dukes ID, Sreenan S, Roe MW, Levisetti M, Zhou YP, Ostrega D, Bell GI, Pontoglio M, Yaniv M, Philipson L, Polonsky KS: Defective pancreatic beta-cell glycolytic signaling in hepatocyte nuclear factor-1alpha-deficient mice. J Biol Chem273 :24457 eC24464,1998
Shiota C, Larsson O, Shelton KD, Shiota M, Efanov AM, Hoy M, Lindner J, Kooptiwut S, Juntti-Berggren L, Gromada J, Berggren PO, Magnuson MA: Sulfonylurea receptor type 1 knock-out mice have intact feeding-stimulated insulin secretion despite marked impairment in their response to glucose. J Biol Chem277 :37176 eC37183,2002
Kulkarni RN, Bruning JC, Winnay JN, Postic C, Magnuson MA, Kahn CR: Tissue-specific knockout of the insulin receptor in pancreatic beta cells creates an insulin secretory defect similar to that in type 2 diabetes. Cell96 :329 eC339,1999
Weinhaus AJ, Poronnik P, Tuch BE, Cook DI: Mechanisms of arginine-induced increase in cytosolic calcium concentration in the beta-cell line NIT-1. Diabetologia40 :374 eC382,1997
Yaekura K, Julyan R, Wicksteed BL, Hays LB, Alarcon C, Sommers S, Poitout V, Baskin DG, Wang Y, Philipson LH, Rhodes CJ: Insulin secretory deficiency and glucose intolerance in Rab3A null mice. J Biol Chem278 :9715 eC9721,2003
Iezzi M, Escher G, Meda P, Charollais A, Baldini G, Darchen F, Wollheim CB, Regazzi R: Subcellular distribution and function of Rab3A, B, C, and D isoforms in insulin-secreting cells. Mol Endocrinol13 :202 eC212,1999
Schluter OM, Khvotchev M, Jahn R, Sudhof TC: Localization versus function of Rab3 proteins: evidence for a common regulatory role in controlling fusion. J Biol Chem277 :40919 eC40929,2002
Hughes SJ: The role of reduced glucose transporter content and glucose metabolism in the immature secretory responses of fetal rat pancreatic islets. Diabetologia37 :134 eC140,1994
Hathout EH, Kumagai AK, Sangkharat A, Geffner ME, Mullen Y: Absence of GLUT2 protein in near-term fetal rat pancreatic islets. Pancreas14 :318 eC321,1997
Garcia-Flores M, Zueco JA, Arenas J, Blazquez E: Expression of glucose transporter-2, glucokinase and mitochondrial glycerolphosphate dehydrogenase in pancreatic islets during rat ontogenesis. Eur J Biochem269 :119 eC127,2002
Yoo HW, Shin YL, Seo EJ, Kim GH: Identification of a novel mutation in the GLUT2 gene in a patient with Fanconi-Bickel syndrome presenting with neonatal diabetes mellitus and galactosaemia. Eur J Pediatr161 :351 eC353,2002
Szebenyi G, Fallon JF: Fibroblast growth factors as multifunctional signaling factors (Review). Int Rev Cytol185 :45 eC106,1999
订阅登记:
请您在下面输入常用的Email地址、职业以便我们定期通过邮箱发送给您最新的相关医学信息,感谢您浏览首席医学网!

