首席网期刊频道
您所在位置: 首页 > 期刊 > 过刊浏览 > 内科学> 《糖尿病学杂志》> 2006年5月55卷5期>文章精华> 文章详情

Blockade of 1 IntegrineCLaminin-5 Interaction Affects Spreading and Insulin Secretion of Rat -Cells Attached on Extracellular Matrix

首席医学网      2006年10月15日 22:03:41 Sunday  
 

作者:Geraldine Parnaud, Eva Hammar, Dominique G. Rouiller, Mathieu Armanet, Philippe A. Halban, and Domenico Bosco

  加入收藏夹

【关键词】  Insulin

    1 Department of Genetic Medicine and Development, University Medical Center, Geneva, Switzerland
    2 Cell Isolation and Transplantation Center, Division of Surgical Research, Department of Surgery, University Hospital, Geneva, Switzerland

    DMEM, Dulbecco’s modified Eagle’s medium; FAK, focal adhesion kinase; HRP, horseradish peroxidase; KRBH, Krebs-Ringer bicarbonate HEPES buffer

    ABSTRACT

    When attached on a matrix produced by a rat bladder carcinoma cell line (804G matrix), rat pancreatic -cells spread in response to glucose and secrete more insulin compared with cells attached on poly-L-lysine. The aim of this study was to determine whether laminin-5 and its corresponding cell receptor 1 integrin are implicated in these phenomena. By using specific blocking antibodies, we demonstrated that laminin-5 is the component present in 804G matrix responsible for the effect of 804G matrix on -cell function and spreading. When expression of two well-known laminin-5 ligands, 1 and 4 integrin, was assessed by Western blot and RT-PCR, only the 1 integrin was detected in -cells. AntieC1 integrin antibody reduced the spreading of -cells on 804G matrix. Blockade of the interaction between 1 integrins and laminin-5 resulted in a reduction in glucose-stimulated insulin secretion. Blocking antieC1 integrin antibody also inhibited focal adhesion kinase phosphorylation induced by 804G matrix. In conclusion, antieC1 integrin and eClaminin-5 antibodies interfere with spreading of -cells, resulting in decreased insulin secretion in response to glucose. Our findings indicate that outside-in signaling via engagement of 1 integrins by laminin-5 is an important component of normal -cell function.

    The extracellular matrix plays a critical role in modulating epithelial cell morphology, growth, migration, and differentiation. The response of cells to extracellular matrix attachment is mediated primarily by the integrin family of adhesion receptors. Integrins are heterodimeric integral membrane glycoproteins composed of an -subunit that is noncovalently linked to a  subunit (1,2). 1 integrins are expressed on most epithelial cells and bind to collagen, fibronectin, laminin-1 (3), and laminin-5 (4). These molecules have been suggested to play important roles in morphogenesis (5,6), cell differentiation (7), polarity, proliferation (8), and survival (8,9).

    In the pancreas, laminin is the major component (80%) of the basement membranes that form the interface between epithelia and connective tissues (10,11), whereas fibronectin is mainly observed underneath endothelial cells and epithelial ducts (12). Both laminin and fibronectin have been shown to affect differentiation and proliferation of -cells (13eC15).

    The importance of celleCextracellular matrix interactions for optimally regulated insulin secretion is supported by a number of studies on -cells cultured on various crude matrices or their purified extracts (15eC21). We have shown that isolated rat islet -cells cultured on the matrix produced by 804G cells (referred to as 804G matrix) secrete twofold more insulin in response to glucose compared with cells cultured on plastic or poly-L-lysine (22,23). This matrix, deposited by 804G rat bladder carcinoma cells, is rich in laminin-5 (24eC26), a heterotrimer protein consisting of 3, 3, and 2 subunits, and an essential component of several epithelial basement membranes (27,28). Our previous study suggests that the effects of 804G matrix on -cells are mediated, at least in part, by laminin-5 (22).

    Within islets, it has previously been shown that 31 and 61 integrins are expressed on rat pancreatic -cells (22,29), and both are receptors for laminin. Furthermore, the level of expression of 61 integrin by -cells correlates with the rate of insulin secretion in response to glucose (22).

    The aim of the current study was to demonstrate that the interaction between laminin-5 and -cell 1 integrins is involved in the effect of 804G matrix on cell spreading and insulin secretion.

    RESEARCH DESIGN AND METHODS

    The antibodies used were hamster anti-rat CD29 (1 integrin chain, Ha2/5), control hamster IgM, and fluorescein isothiocyanateeCconjugated mouse anti-hamster from Becton Dickinson Pharmingen (San Jose, CA); antieC2 chain of laminin-5, antieC4 integrin, and antieCfocal adhesion kinase (FAK) from Santa Cruz Biotechnology (Santa Cruz, CA); rabbit antieCphospho-FAK (Tyr-397) from Biosource International (Camarillo, CA); anti-fibronectin, control mouse, and rabbit IgG from Sigma (Buchs, Switzerland); antieC3 chain of laminin-5 (CM6), a gift from of Dr. Vito Quaranta (the Scripps Research Institute, La Jolla, CA); monoclonal anti-actin from Chemicon International (Temecula, CA); and antieCmouseeChorseradish peroxidase (HRP), antieCrabbit-HRP, and antieCgoat-HRP from Amersham Pharmacia Biotech (Dubendorf, Switzerland).

    Islet isolation and -cell purification.

    Islets of Langerhans were isolated by collagenase digestion of pancreases from 180- to 200-g male Wistar rats (Janvier, Le Genest-St-Isle, France) followed by Ficoll purification, using a modification of the method of Sutton et al. (30). Islets were trypsinized and -cells purified, using a fluorescence-activated cell sorter (FACStar-Plus; Becton Dickinson, Sunnyvale, CA), as previously described (31,32), to yield a population of >95% -cells.

    804G matrix.

    804G cells were grown in Dulbecco’s modified Eagle’s medium (DMEM; Gibco, Invitrogen, Basel, Switzerland) containing 10% FCS and 5.6 mmol/l glucose (33). At confluence, cells were washed and maintained for 3 days in DMEM without FCS. Conditioned medium was centrifuged (180g, 5 min), filtered (0.22 e), and frozen at eC20°C, and hereafter it will be referred to as 804G matrix.

    Coating of dishes and slides.

    Petri dishes (35 mm diameter) were coated with 100 e/ml fibronectin, 75 e/ml vitronectin, or 100 mg/ml laminin from EHS sarcoma cells (Sigma) in 20 mmol/l carbonate, pH 9.6, and incubated for 90 min at 37°C, and nonspecific binding sites were blocked with 0.5% BSA for 30 min at 37°C. Aliquots (60 e) of 804G matrix or 100 e/ml poly-L-lysine were layered at the center of Petri dishes. The glass microscope slides used as Cunningham’s chambers (34) were coated with 300 e of 804G matrix or 100 e/ml poly-L-lysine. After coating for 18eC20 h in a damp box at 37°C, Petri dishes and glass slides were washed 3 times with sterile H2O and air dried. Where appropriate, dishes coated with poly-L-lysine or 804G matrix were incubated for 2 h at 37°C with either antieClaminin-5 (100 e/ml) or anti-fibronectin antibody (50 e/ml) in PBS, 0.5% BSA. Nonimmune mouse or rabbit IgG were used as controls. Dishes were washed 3 times with PBS and air-dried.

    Culture and attachment of cells to Petri dishes.

    Sorted -cells were washed twice with DMEM, 10% FCS, 11.2 mmol/l glucose, 1 mmol/l sodium pyruvate, 110 units/ml penicillin, 110 e/ml streptomycin, and 50 e/ml gentamicin (control medium). Aliquots of 3 x 105 cells were seeded in nonadherent 100-mm-diameter Petri dishes containing 9 ml control medium and incubated for 20 h at 37°C to allow full recovery from islet isolation or cell purification. The cells were then resuspended at 4 x 105 cells/ml in the control medium, and 50-e droplets were plated on Petri dishes coated as described. Cells were analyzed 24 h later. To evaluate the effect of antieC1 integrin blocking antibody, cells were resuspended at a density of 106 cells/ml in DMEM containing 11.2 mmol/l glucose and 10% FCS and preincubated for 1 h with 2 g/e antieC1 integrin blocking antibody (Ha2/5) or purified hamster IgM or vehicle. Then, cells were plated as droplets at the center of Petri dishes coated with 804G matrix or poly-L-lysine, incubated for 5 h at 37°C, fixed with 4% paraformaldehyde (20 min, room temperature), and stained with Evans blue (0.06% in PBS). Phase-contrast views of different fields were photographed, and the cell profile area was measured, using ScionImage software (Fredrick, MD).

    Insulin secretion assay and insulin content.

    -Cells pretreated with 2 e/ml Ha2/5 antibody as described above were washed twice with Krebs-Ringer bicarbonate HEPES buffer (KRBH; 125 mmol/l NaCl, 4.74 mmol/l KCl, 1 mmol/l CaCl2, 1.2 mmol/l KH2PO4, 1.2 mmol/l MgSO4, 5 mmol/l NaHCO3, 25 mmol/l HEPES, pH 7.4, and 0.1% BSA) containing 2.8 mmol/l glucose and plated on poly-L-lysineeCor 804G matrixeCcoated dishes. Purified hamster IgM (2 e/ml) or vehicle were added as controls. Cells were cultured in the continued presence of the antibody for 2 h. Cells attached on Petri dishes were washed 3 times with KRBH and preincubated 1 h at 37°C with KRBH containing 2.8 mmol/l glucose, followed by successive 1-h incubations at 37°C in KRBH with 2.8 or 16.7 mmol/l glucose. Insulin was extracted from cells with acid-ethanol, and insulin in buffers and extracts were measured by radioimmunoassay with rat insulin as the standard. Total insulin is the sum of cellular insulin and insulin secreted during the first and second incubation periods.

    Reverse hemolytic plaque assay.

    Insulin secretion from single -cells was assessed by reverse hemolytic plaque assay, as previously described (22). Briefly, -cells, pretreated 1 h at 37°C in suspension with Ha2/5 antibody or vehicle, were diluted in KRBH containing 2.8 mmol/l glucose. Packed sheep erythrocytes (5% vol/vol; Behring Institute, Marburg, Germany) previously coated with protein A were then mixed with -cells, and 60-e aliquots of this preparation were inserted in Cunningham’s chambers. After a 2-h incubation at 37°C in the presence or absence of 1 or 2 e/ml Ha2/5 antibody, the chambers were rinsed with KRBH containing either 2.8 or 16.7 mmol/l glucose and then filled with the same buffer supplemented with heat-inactivated (45 min at 56°C) anti-insulin guinea pig serum (1:300 dilution) (35). After a 1-h incubation at 37°C, chambers were rinsed with KRBH containing 2.8 mmol/l glucose, filled with the same buffer containing guinea pig complement (1:40 dilution; Behring Institute), and incubated 1 h at 37°C. Chambers were then filled with 0.04% (wt/vol) trypan blue in KRBH, rinsed with KRBH, and filled with Bouin’s fixative. After rinsing in PBS, slides were covered with PBS-glycerol (1:2 dilution, vol/vol) and screened by microscopy.

    Immunofluorescence.

    Cells were preincubated for 1 h in suspension with 2 e/ml Ha2/5 antibody or purified hamster IgM and then attached on poly-L-lysineeCor 804G matrixeCcoated glass. After 2 h of culture, cells were washed with PBSeC0.5% BSA and incubated for 1 h at 4°C with fluorescein isothiocyanateeCconjugated mouse anti-hamster monoclonal antibody. Then, cells were fixed with 4% paraformaldehyde (20 min, room temperature), rinsed, and mounted under glass coverslips. The preparations were observed with an Axiocam fluorescence microscope.

    Western blot.

    Cells were washed with ice-cold PBS with 1 mmol/l sodium vanadate and lysed in sample buffer (62 mmol/l Tris-HCl, pH 6.8, 2% SDS, 5% glycerol, and 1% 2-mercaptoethanol). Protein concentrations were determined with the amido black method (36), and equal amounts of total protein were loaded for SDS-PAGE. All samples, after separation on an SDS-PAGE gel, were electroblotted onto nitrocellulose membranes (Schleicher & Schuell, Dassel, Germany) for immunoblotting with the appropriate antibody. An enhanced chemiluminescence protein detection kit (Amersham Biosciences) and a Kodak image station were used for visualization of the bands.

    Semiquantitative RT-PCR.

    Total RNA was extracted, using a QIAshredder and RNeasy mini kits (Qiagen, Basel, Switzerland) according to the manufacturer’s instructions, and stored at eC80°C. RNA quality was verified by agarose gel electrophoresis. First-strand cDNA was synthesized by oligo dT priming of 1 e total RNA, using a superscript II RT kit (Invitrogen) according to the manufacturer’s protocol. PCR amplification of cDNAs was performed in a total reaction volume of 50 e that contained 1 e of the RT reaction product, 0.25 e of 5 units/e Hot Gold Star DNA polymerase (Invitrogen), 5 e of 10x PCR buffer, 1 e of 10 mmol/l dNTPs, 4 e of 25 mmol/l MgCl2, and 1 eol of each sense and antisense primer of the target gene. The following oligonucleotide primer sets were used: 1 integrin forward: GAGAGAGATTACTTCAGAC, reverse: AGCAGTCGTGTTACATTC; 4 integrin forward: GGGTCTTATACTGGGTGTAGG, reverse: CAGCTGACCCCTGTGGACT; laminin-5eC2 chain forward: TGTACCCAGTGTTTCTGCTAT, reverse: CTCCTCTGTCCACGCGGTAG; and fibronectin forward: CCGGGTTCTGAGTACACAGTC, reverse: AGGGACCACTTCTCTGGGAGG. PCR amplification was initiated by one cycle of 95°C for 5 min followed by 35 sequential cycles of denaturation at 95°C for 45 s, annealing at melting temperature for 1 min, extension at 72°C for 2 min, and a final extension cycle at 72°C for 10 min in a thermocycler. As a negative control, the RT negative reaction product was added in the reaction. The presence of a single band amplified with specific primers for glyceraldehyde-3-phosphate dehydrogenase (forward: AATGCATCCTGCACCACC; reverse: GTAGCCATATTCATTGTCATA) or actin (forward: CGTGGGCCGCCCTAGGCACCAG; reverse: TTGGCCTTAGGGTTCAGGGGGG) with the same cDNA was used as an internal control under identical conditions. Each experiment was repeated at least three times. PCR products were separated on Tris-acetate-EDTA 2% agarose gels containing ethidium bromide and photographed under UV illumination.

    Immunohistochemistry.

    Pancreas sections (4-e-thick) were cut from whole-tissue blocks and mounted on silane-coated glass slides. Paraffin sections were dewaxed, rehydrated with ethanol, and reacted with 5% hydrogen peroxide in methanol for 10 min to quench endogenous peroxidase activity. The sections were then treated with 0.1% trypsin for 30 min and incubated in 5% BSA for 15 min to block nonspecific binding of the antibody. After incubation for 1 h at room temperature with goat antieClaminin-5eC2 diluted 1:100 in 5% BSA, biotinylated anti-goat IgG was applied for 30 min. Then, the slides were incubated with the peroxidase avidin-biotin complex for 30 min. The peroxidase reaction was developed in a diaminobenzidine tetrahydrochloride solution containing 0.01% hydrogen peroxidase. As a control, antieClaminin-5eC2 antibody preadsorbed with laminin-5eC2 peptide (Santa Cruz) or goat IgG were used instead of antieClaminin-5eC2 antibody.

    Data and statistical analysis.

    Data are the means ± SE for n independent experiments. Levels of significance for differences between groups were assessed by least significant difference ANOVA or by Student’s t test for unpaired groups, using SPSS software.

    RESULTS

    Preferential attachment and spreading of -cells on 804G matrix compared with vitronectin, fibronectin, or EHS laminin.

    As reported previously (22), -cells adhere and spread on 804G matrix (Fig. 1A). To assess their attachment and spreading on other matrices, -cells were seeded into Petri dishes coated with vitronectin, fibronectin, or laminin from basement membrane of EHS sarcoma cells. After 24 h, few cells were attached onto dishes coated with EHS matrix and vitronectin (Fig. 1BeCC), whereas the majority of cells attached as clusters to dishes coated with fibronectin (Fig. 1D). However, cells were only found attached and well spread on dishes coated with 804G matrix.

    Inhibitory effect of antieClaminin-5 antibody on -cell spreading and insulin secretion.

    The expression of laminin-5 in 804G cells was confirmed by immunoblot analysis of 804G matrix. The CM6 antibody specifically detected a 160-kDa band corresponding to the 3 chain of laminin-5, and the 150-kDa band was stained with the antieC2 chain antibody. A 220-kDa band was also detectable by immunoblotting with anti-fibronectin antibody (Fig. 2). Then, to determine whether both laminin-5 and fibronectin are implicated in spreading of -cells on 804G matrix, we used antieClaminin-5 and anti-fibronectin as blocking antibodies. -Cells cultured on 804G matrix rapidly flattened and spread out, losing refringence compared with cells cultured on poly-L-lysine (Fig. 3A). Mouse IgG, used as control, did not affect the morphology of cells plated on either poly-L-lysine or 804G matrix. AntieClaminin-5 antibody did not interfere with attachment of cells on poly-L-lysine. However, spreading of -cells on 804G matrix was significantly inhibited by antieClaminin-5 antibody compared with cells incubated without antibody. In the presence of antieClaminin-5 antibody, cell morphology was similar on poly-L-lysine and on 804G matrix. By contrast, anti-fibronectin antibody did not affect -cell spreading on 804G matrix (Fig. 3A), whereas it completely inhibited attachment of cells on fibronectin-coated dishes, demonstrating its efficiency as a blocking antibody (data not shown). These results suggest that laminin-5, and not fibronectin, is an essential component of 804G in inducing -cell spreading.

    To assess whether laminin-5 is essential for increased glucose-induced insulin secretion, -cells were plated on 804G matrix previously treated with antieClaminin-5 antibody (CM6 antibody, 100 e/ml) and then submitted to a static secretion test. 804G matrix, as expected, increased insulin secreted at 16.7 mmol/l glucose by twofold (P = 0.003) compared with poly-L-lysine (Fig. 3B). When 804G matrix was treated with CM6 antibody, stimulated insulin secretion was significantly reduced (P = 0.01) and was similar to that of -cells attached on poly-L-lysine. Basal secretion was not affected by CM6 antibody. Anti-fibronectin antibody and control IgG did not affect either basal or stimulated insulin secretion (Fig. 3B). This result suggests that laminin-5 is involved in increased insulin secretion induced by 804G matrix.

    4 integrin is not expressed in islets.

    31 and 61 integrins are receptors for laminin-5 and are known to be expressed by islet -cells (22). 64 integrin is also a ligand for laminin-5, but its expression has not been studied so far in -cells. 804G cells were used as a positive control. RT-PCR showed expression of 4 subunit in 804G cells but not in -cells, whereas expression of 1 subunit was observed in both 804G cells and -cells (Fig. 4A). By immunoblotting we confirmed that -cells express 1 but not 4 integrin subunit and that both integrin subunits were expressed in 804G cells (Fig. 4B). These results suggest that only integrins of the 1 family are involved in -cell binding to 804G matrix.

    Inhibitory effect of antieC1 integrin antibody on -cell spreading and insulin secretion.

    To confirm that 1 integrins mediate adhesion of -cells to 804G matrix, a monoclonal antibody against the 1 integrin subunit (Ha2/5) was tested as an inhibitor. By immunofluorescence, we confirmed the binding of this antibody on the surface of living -cells (Fig. 4C). Then we analyzed the effect of Ha2/5 antibody on spreading of -cells cultured for 5 h on poly-L-lysine or 804G matrix. -Cell spreading on 804G matrix was significantly decreased when cells were incubated with Ha2/5 antibody (P = 0.035), whereas cells treated with hamster IgM were not affected (Fig. 5).

    To test whether 1 integrins are involved in the effect of 804G matrix on insulin secretion, -cells were attached for 2 h on Petri dishes coated or not coated with 804G matrix in the presence or absence of Ha2/5 antibody (1 or 2 e/ml) and submitted to a static secretion test. As expected, 804G matrix induced a significant increase of glucose-stimulated insulin secretion compared with cells plated on poly-L-lysine (P = 0.02) (Fig. 6A). Ha2/5 antibody decreased stimulated insulin secretion of -cells attached to 804G matrix (P = 0.016), so that no more difference was observed between poly-L-lysine and 804G (Fig. 6A). This antibody did not affect basal or stimulated insulin secretion of cells plated on poly-L-lysine (Fig. 6A). Similar results were obtained when insulin secretion from single cells was studied by reverse hemolytic plaque assay (Fig. 6B). These results suggest that 1 integrins are involved in the stimulatory effect of 804G matrix on insulin secretion and that this effect persists even when secretion from single cells, deprived of intercellular contacts, are studied.

    Blocking antieC1 integrin antibody inhibits FAK phosphorylation.

    In a previous study, we showed that 804G matrix induces phosphorylation of FAK, a signaling protein that is activated on integrin ligand binding (37). Here, we studied the phosphorylation status of FAK in the presence of Ha2/5 antibody (Fig. 7). Adhesion of -cells to 804G matrix resulted in a significant increase in FAK Tyr397 phosphorylation compared with adhesion to the control substrate poly-L-lysine (2.5-fold increase, P < 0.05). Blocking antieC1 integrin antibody significantly decreased Tyr397 phosphorylation of FAK after adhesion to 804G matrix (86% inhibition compared with control cells adherent to 804G matrix, P = 0.03) but not to poly-L-lysine. 1 integrins are thus involved in 804G matrixeCinduced FAK phosphorylation of -cells.

    Assessment of extracellular matrix molecule expression in pancreatic islet.

    Having demonstrated that laminin-5 is implicated in 804G matrixeCinduced insulin secretion, we verified its expression in pancreatic islets. Expression of the characteristic 2 chain of laminin-5 was studied by semiquantitative RT-PCR, Western blotting, and immunohistochemistry in rat and human islets. Results indicate that laminin-5, as well as fibronectin, are expressed in rat and human islets (Fig. 8A). Furthermore, when rat -cells and noneC-cells were sorted, laminin-5eC2 transcript was mainly observed in noneC-cells. However, fibroblastoid cells obtained by culturing noneC-cell fraction during several weeks did not express laminin-5 but, as expected, they expressed fibronectin (Fig. 8A). These results were confirmed at the protein level by Western blot (Fig. 8C). By immunohistochemistry, labeling of laminin-5eC2 chain was observed in the endocrine cells at the periphery of the -cell core in rat and human islets (Fig. 8B). These positive cells were shown to express glucagon, as determined by double immunostaining (data not shown). Furthermore, when the antieClaminin-5eC2 antibody was preadsorbed with laminin-5eC2 peptide or when nonimmune goat IgG was used instead of the antieClaminin-5eC2 antibody, no laminin-5eC2 labeling was observed.

    DISCUSSION

    We show here that antieC1 integrin and antieClaminin-5 blocking antibodies interfere with spreading of -cells on 804G matrix and with insulin secretion in response to glucose. These observations suggest that both 1 integrins and their cognate substrate, laminin-5, are important for the beneficial effect of 804G matrix on -cell function.

    A role of laminin-5 in -cell function had been suggested by our previous work showing that 804G matrixeCinduced spreading of rat islet -cells was prevented by antieClaminin-5 antibody (22). Furthermore, experiments performed with laminin-5 purified from 804G matrix suggest that this component is responsible for a pro-survival role on -cells (37). Although these earlier studies suggested that laminin-5 could be implicated in spreading and increased survival of -cells on 804G matrix, it remained unclear whether this also holds true for increased insulin secretion on this matrix. We now not only confirm that laminin-5 is implicated in -cell spreading, but we also show that this protein contributes to increased glucose-stimulated insulin secretion on 804G matrix. It remains to be established whether this is caused by direct signaling from the matrix to the exocytotic machinery and/or pathways that regulate exocytosis or by indirect effects perhaps secondary to increased cell spreading or decreased apoptosis.

    A continuous periinsular extracellular matrix that contains laminin, fibronectin, and collagen types IV and V has been described in human pancreas (21,38). Other studies have shown that basement membrane structure and major extracellular matrix proteins are not found between islet cells (11,38,39). Within the islet, basement membrane was observed only around capillaries (21). In humans, collagen IV was detected in association with the islet microvasculature (40). Intimate relationships between individual -cells and islet capillaries, and direct contact between -cells and subendothelial basement membrane, have been confirmed by electron microscopy studies (41,42). In human pancreas, basement membrane of duct cells showed immunoreactivity for ladsin, a homolog of laminin-5, but in this study, islets were not analyzed (43). The expression and localization of laminins are poorly documented, and the presence of laminin-5 in islets has not been reported previously. In this study we demonstrated that laminin-5 is expressed in rat and human islets, mainly in -cells. This is in agreement with data showing that in some circumstances, -cells may improve the function of -cells (44), and this could be attributable to provision of a more appropriate extracellular matrix as well as possible paracrine effects of glucagon. Moreover, laminin-5 was also detected in islet culture media (data not shown), suggesting this molecule could be secreted by insular cells. Whether laminin-5 is part of the basal lamina depositing under islet endocrine cells remains to be demonstrated. Whatever laminin isoform is expressed in islets in vivo, it is reasonable to expect that this isoform could play a similar role in activating 1 integrin receptors on -cells as laminin-5 does in vitro.

    Integrins are a large family of adhesion receptors that mediate cell-matrix and cell-cell adhesion (45). Our group has shown that rat pancreatic -cells express 61 and 31 integrins (22,29), which are receptors for laminin-5. 64 integrin is another well-known receptor of laminin-5. Here, we show by RT-PCR and Western blot that 4 subunit integrin is not expressed in rat -cells. This is in agreement with previous work showing that human -cells express mRNA for the integrin subunits 3, 5, 6, and 1 but not 4 (46). It was shown previously that function-blocking antibodies directed against the 6 integrin subunit blocked cell spreading induced by 804G matrix (22). The expression of this 6 integrin subunit is regulated by glucose and correlates with insulin expression (22). However, the antieC6 integrin blocking antibody does not affect insulin release (D.B., unpublished observations). This is expected because other integrin subunits known to partner 1, such as 3, 5, and v, have been shown to be expressed on -cells and may play a role in insulin secretion (47). Here, we used a blocking 1 integrin subunit antibody that interferes with all 1 integrin heterodimers, and we showed that this prevented both the spreading and the improved insulin secretion induced by 804G matrix. These results suggest that engagement of 1 integrins by laminin-5 plays an important role in the maintenance of optimally regulated -cell function. This subunit associates with different -subunits, and thus more than one 1 integrin heterodimer might participate in this phenomenon. These data are the first to implicate laminin-integrin binding in the regulation of insulin secretion and spreading of purified and isolated adult -cells. It has been previously reported that 11 and collagen IV contribute to -cell functions known to be important for islet morphogenesis (40). Furthermore, the 1 family of integrin has been shown to be involved in early pancreatic developmental events (47,48), including differentiation and maturation of islets (6).

    There is evidence that on integrin activation, a cascade of protein phosphorylations on tyrosine residues activates intracellular signaling pathways (49). FAK was identified as a tyrosine-phosphorylated protein that localized at focal contacts and acts downstream of growth factor and integrin receptors. We showed previously that 804G matrix induces phosphorylation of FAK (37). Here, we demonstrated that the function-blocking antibody directed against 1 integrin subunit inhibited phosphorylation of FAK induced by 804G matrix. The treatment of cells with an equal amount of IgM antibody did not compromise -cell spreading, insulin secretion, and FAK phosphorylation, indicating that the interference with 1 function by blocking antibody is not the result of nonspecific interactions.

    In summary, our study shows that the function of dispersed primary pancreatic -cells can be maintained by attachment to 804G matrix in vitro. This maintenance of an optimally regulated -cell function is mediated by 1 integrineClaminin-5 interaction. It is concluded that outside-in signaling via engagement of 1 integrins by laminin-5 is an important component of normal -cell function.

    ACKNOWLEDGMENTS

    This work was supported by research Grants 3200B0-100656/1 (to D.G.R.) and 3200B0-1001902 (to P.A.H.) from the Swiss National Science Foundation and an unrestricted educational grant from Novo Nordisk, Copenhagen.

    We thank Caroline Raveraud-Rouget for expert technical assistance.

    FOOTNOTES

    The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

    REFERENCES

    Blystone SD: Integrating an integrin: a direct route to actin. Biochim Biophys Acta 1692:47eC54, 2004

    Qin J, Vinogradova O, Plow EF: Integrin bidirectional signaling: a molecular view (Review). PLoS Biol 2:e169, 2004

    Kikkawa Y, Yu H, Genersch E, Sanzen N, Sekiguchi K, Fassler R, Campbell KP, Talts JF, Ekblom P: Laminin isoforms differentially regulate adhesion, spreading, proliferation, and ERK activation of beta1 integrin-null cells. Exp Cell Res 300:94eC108, 2004

    Carter WG, Ryan MC, Gahr PJ: Epiligrin, a new cell adhesion ligand for integrin alpha 3 beta 1 in epithelial basement membranes. Cell 65:599eC610, 1991

    Fassler R, Meyer M: Consequences of lack of beta 1 integrin gene expression in mice. Genes Dev 9:1896eC1908, 1995

    Yashpal NK, Li J, Wheeler MB, Wang R: Expression of {beta}1 integrin receptors during rat pancreas development: sites and dynamics. Endocrinology 146:1798eC1807, 2005

    Faraldo MM, Deugnier MA, Tlouzeau S, Thiery JP, Glukhova MA: Perturbation of beta1-integrin function in involuting mammary gland results in premature dedifferentiation of secretory epithelial cells. Mol Biol Cell 13:3521eC3531, 2002

    Benaud CM, Dickson RB: Regulation of the expression of c-Myc by beta1 integrins in epithelial cells. Oncogene 20:759eC768, 2001

    Pinkse GG, Voorhoeve MP, Noteborn M, Terpstra OT, Bruijn JA, De Heer E: Hepatocyte survival depends on beta1-integrin-mediated attachment of hepatocytes to hepatic extracellular matrix. Liver Int 24:218eC226, 2004

    Aumailley M, Smyth N: The role of laminins in basement membrane function. J Anat 193 (Pt. 1):1eC21, 1998

    Jiang FX, Naselli G, Harrison LC: Distinct distribution of laminin and its integrin receptors in the pancreas. J Histochem Cytochem 50:1625eC1632, 2002

    Cirulli V, Beattie GM, Klier G, Ellisman M, Ricordi C, Quaranta V, Frasier F, Ishii JK, Hayek A, Salomon DR: Expression and function of alpha (v)beta(3) and alpha(v)beta(5) integrins in the developing pancreas: roles in the adhesion and migration of putative endocrine progenitor cells. J Cell Biol 150:1445eC1460, 2000

    Hulinsky I, Harrington J, Cooney S, Silink M: Insulin secretion and DNA synthesis of cultured islets of Langerhans are influenced by the matrix. Pancreas 11:309eC314, 1995

    Hulinsky I, Cooney S, Harrington J, Silink M: In vitro growth of neonatal rat islet cells is stimulated by adhesion to matrix. Horm Metab Res 27:209eC215, 1995

    Edamura K, Nasu K, Iwami Y, Ogawa H, Sasaki N, Ohgawara H: Effect of adhesion or collagen molecules on cell attachment, insulin secretion, and glucose responsiveness in the cultured adult porcine endocrine pancreas: a preliminary study. Cell Transplant 12:439eC446, 2003

    Beattie GM, Lappi DA, Baird A, Hayek A: Functional impact of attachment and purification in the short term culture of human pancreatic islets. J Clin Endocrinol Metab 73:93eC98, 1991

    Kaiser N, Corcos AP, Sarel I, Cerasi E: Monolayer culture of adult rat pancreatic islets on extracellular matrix: modulation of B-cell function by chronic exposure to high glucose. Endocrinology 129:2067eC2076, 1991

    Lucas-Clerc C, Massart C, Campion JP, Launois B, Nicol M: Long-term culture of human pancreatic islets in an extracellular matrix: morphological and metabolic effects. Mol Cell Endocrinol 94:9eC20, 1993

    Perfetti R, Henderson TE, Wang Y, Montrose-Rafizadeh C, Egan JM: Insulin release and insulin mRNA levels in rat islets of Langerhans cultured on extracellular matrix. Pancreas 13:47eC54, 1996

    Nagata N, Gu Y, Hori H, Balamurugan AN, Touma M, Kawakami Y, Wang W, Baba TT, Satake A, Nozawa M, Tabata Y, Inoue K: Evaluation of insulin secretion of isolated rat islets cultured in extracellular matrix. Cell Transplant 10:447eC451, 2001

    Wang RN, Rosenberg L: Maintenance of beta-cell function and survival following islet isolation requires re-establishment of the islet-matrix relationship. J Endocrinol 163:181eC190, 1999

    Bosco D, Meda P, Halban PA, Rouiller DG: Importance of cell-matrix interactions in rat islet -cell secretion in vitro: role of 61 integrin. Diabetes 49:233eC243, 2000

    Bosco D, Gonelle-Gispert C, Wollheim CB, Halban PA, Rouiller DG: Increased intracellular calcium is required for spreading of rat islet beta-cells on extracellular matrix. Diabetes 50:1039eC1046, 2001

    Langhofer M, Hopkinson SB, Jones JC: The matrix secreted by 804G cells contains laminin-related components that participate in hemidesmosome assembly in vitro. J Cell Sci 105 (Pt. 3):753eC764, 1993

    Hormia M, Falk-Marzillier J, Plopper G, Tamura RN, Jones JC, Quaranta V: Rapid spreading and mature hemidesmosome formation in HaCaT keratinocytes induced by incubation with soluble laminin-5r. J Invest Dermatol 105:557eC561, 1995

    Baker SE, Hopkinson SB, Fitchmun M, Andreason GL, Frasier F, Plopper G, Quaranta V, Jones JC: Laminin-5 and hemidesmosomes: role of the alpha 3 chain subunit in hemidesmosome stability and assembly. J Cell Sci 109 (Pt. 10):2509eC2520, 1996

    Colognato H, Yurchenco PD: Form and function: the laminin family of heterotrimers. Dev Dyn 218:213eC234, 2000

    Aumailley M, El Khal A, Knoss N, Tunggal L: Laminin 5 processing and its integration into the ECM. Matrix Biol 22:49eC54, 2003

    Kantengwa S, Baetens D, Sadoul K, Buck CA, Halban PA, Rouiller DG: Identification and characterization of alpha 3 beta 1 integrin on primary and transformed rat islet cells. Exp Cell Res 237:394eC402, 1997

    Sutton R, Peters M, McShane P, Gray DW, Morris PJ: Isolation of rat pancreatic islets by ductal injection of collagenase. Transplantation 42:689eC691, 1986

    Rouiller DG, Cirulli V, Halban PA: Differences in aggregation properties and levels of the neural cell adhesion molecule (NCAM) between islet cell types. Exp Cell Res 191:305eC312, 1990

    Van De Winkel M, Smets G, Gepts W, Pipeleers D: Islet cell surface antibodies from insulin-dependent diabetics bind specifically to pancreatic B cells. J Clin Invest 70:41eC49, 1982

    Riddelle KS, Green KJ, Jones JC: Formation of hemidesmosomes in vitro by a transformed rat bladder cell line. J Cell Biol 112:159eC168, 1991

    Salomon D, Meda P: Heterogeneity and contact-dependent regulation of hormone secretion by individual B cells. Exp Cell Res 162:507eC520, 1986

    Wright PH, Makulu DR, Posey IJ: Guinea pig anti-insulin serum: adjuvant effect of H. pertussis vaccine. Diabetes 17:513eC516, 1968

    Schaffner W, Weissmann C: A rapid, sensitive, and specific method for the determination of protein in dilute solution. Anal Biochem 56:502eC514, 1973

    Hammar E, Parnaud G, Bosco D, Perriraz N, Maedler K, Donath M, Rouiller DG, Halban PA: Extracellular matrix protects pancreatic beta-cells against apoptosis: role of short- and long-term signaling pathways. Diabetes 53:2034eC2041, 2004

    Van Deijnen JH, Van Suylichem PT, Wolters GH, Van Schilfgaarde R: Distribution of collagens type I, type III and type V in the pancreas of rat, dog, pig and man. Cell Tissue Res 277:115eC121, 1994

    Like AA, Appel MC, Williams RM, Rossini AA: Streptozotocin-induced pancreatic insulitis in mice: morphologic and physiologic studies. Lab Invest 38:470eC486, 1978

    Kaido T, Yebra M, Cirulli V, Montgomery AM: Regulation of human beta-cell adhesion, motility, and insulin secretion by collagen IV and its receptor alpha1beta1. J Biol Chem 279:53762eC53769, 2004

    Bonner-Weir S: Morphological evidence for pancreatic polarity of beta-cell within islets of Langerhans. Diabetes 37:616eC621, 1988

    Konstantinova I, Lammert E: Microvascular development: learning from pancreatic islets. Bioessays 26:1069eC1075, 2004

    Kawano N, Kitamura H, Ito T, Takimoto A, Nakatani Y, Miyazaki K: Localization of ladsin, a homolog of laminin-5, in normal adult human tissues: immunohistochemical and immunoelectron microscopic studies. Med Electron Microsc 32:25eC35, 1999

    Keymeulen B, Anselmo J, Pipeleers D: Length of metabolic normalization after rat islet cell transplantation depends on endocrine cell composition of graft and on donor age. Diabetologia 40:1152eC1158, 1997

    Berman AE, Kozlova NI, Morozevich GE: Integrins: structure and signaling. Biochemistry (Mosc) 68:1284eC1299, 2003

    Ris F, Hammar E, Bosco D, Pilloud C, Maedler K, Donath MY, Oberholzer J, Zeender E, Morel P, Rouiller D, Halban PA: Impact of integrin-matrix matching and inhibition of apoptosis on the survival of purified human beta-cells in vitro. Diabetologia 45:841eC850, 2002

    Wang R, Li J, Lyte K, Yashpal NK, Fellows F, Goodyer CG: Role for 1 integrin and its associated 3, 5, and 6 subunits in development of the human fetal pancreas. Diabetes 54:2080eC2089, 2005

    Kaido T, Perez B, Yebra M, Hill J, Cirulli V, Hayek A, Montgomery AM: Alphav-integrin utilization in human beta-cell adhesion, spreading, and motility. J Biol Chem 279:17731eC17737, 2004

    Dogic D, Eckes B, Aumailley M: Extracellular matrix, integrins and focal adhesions. Curr Top Pathol 93:75eC85, 1999

  订阅登记:

请您在下面输入常用的Email地址、职业以便我们定期通过邮箱发送给您最新的相关医学信息,感谢您浏览首席医学网!

邮箱:    职业: