首席网期刊频道
您所在位置: 首页 > 期刊 > 过刊浏览 > 内科学> 《糖尿病学杂志》> 2006年9月55卷9期>文章精华> 文章详情

Nuclear Factor-B Regulates -Cell Death

首席医学网      2007年03月26日 21:00:04 Monday  
 

作者:David Liuwantara, Mark Elliot, Mariya W. Smith, Andrew O. Yam, Stacy N. Walters, Eliana Marino, Andy McShea, and Shane T. Grey

  加入收藏夹

【关键词】  Cell

    1 Arthritis and Inflammation Program, Garvan Institute for Medical Research, Darlinghurst, New South Wales, Australia
    2 Biology and Chemistry Section, CombiMatrix Corporation, Mukilteo, Washington

    FACS, fluorescence-activated cell sorter; FADD, Fas-associated death domain; FADD-DN, FADD dominant negative inhibitor; -gal, -galactosidase; IL, interleukin; IFN, interferon; IB, inhibitor of NF-B; NF-B, nuclear factor-B; NIK, NF-B-inducing kinase; PKD, protein kinase D; Th, T-helper; TLR, Toll-like receptor; TNF, tumor necrosis factor; TNF-R, TNF receptor; TRAF, TNF receptorassociated factor

    ABSTRACT

    Apoptotic -cell death is central to the pathogenesis of type 1 diabetes and may be important in islet graft rejection. Despite this, genetic control of -cell apoptosis is only poorly understood. We report that inhibition of gene transcription sensitized -cells to tumor necrosis factor (TNF)-induced apoptosis, indicating the presence of a regulated antiapoptotic response. Using oligonucleotide microarrays and real-time PCR, we identified TNFAIP3/A20 as the most highly regulated antiapoptotic gene expressed in cytokine-stimulated human and mouse islets. Cytokine induction of A20 mRNA in primary islets and insulinoma cells was rapid and observed within 1 h, consistent with A20 being an immediate early response gene in -cells. Regulation of A20 was nuclear factor-B (NF-B)dependent, two NF-B sites within the A20 promoter were found to be necessary and sufficient for A20 expression in -cells. Activation of NF-B by TNF receptorassociated factor (TRAF) 2, TRAF6, NF-Binducing kinase, or protein kinase D, which transduce signals downstream of Toll-like receptors, TNF receptors, and free radicals, respectively, were all potent activators of the A20 promoter. Moreover, A20 expression was induced in transplanted islets in vivo. Finally, A20 expression was sufficient to protect -cells from TNF-induced apoptosis. These data demonstrate that A20 is the cardinal antiapoptotic gene in -cells. Further, A20 expression is NF-B dependent, thus linking islet proinflammatory gene responses with protection from apoptosis.

    Apoptosis or programmed cell death is a genetically controlled response of the cell to commit suicide (1,2). Apoptosis is the physiological process for cell deletion in normal, reorganizing, or involuting tissue and is required for shaping of the endocrine pancreas (3,4). Aside from its role in normal cell biology, -cell apoptosis has been implicated in the pathophysiology of type 1 diabetes, both at its initiation phase and as the final effector mechanism (5,6). Evidence from the NOD mouse (a widely studied model of autoimmune diabetes) (7) indicates that autoreactive cytolytic T-cells (8), as well as soluble mediators including proinflammatory cytokines and free radicals, contribute to increased -cell apoptotic destruction during the pathogenesis of type 1 diabetes (6,9). Transplantation of islets is considered to be one potential approach that could restore normal metabolic control for the cure of type 1 diabetes. However, multiple obstacles are faced in islet transplants, including cellular rejection akin to the mechanisms involved in autoimmune destruction of -cells, and also primary nonfunction, a phenomena related to lack of nutrients, hypoxia, and nonspecific inflammatory mediators (1012).

    Despite the importance of apoptosis in the pathophysiology of -cell death, the genetic control of apoptosis in islets is poorly understood. Determining the molecular basis of -cell susceptibility to apoptosis would increase our understanding of the mechanisms underscoring -cell loss, as well as reveal potential gene therapy candidates for the creation of "death-defying" islets (13), capable of resisting immune and nonimmune insults. With this goal in mind, we generated a custom microarray, a so-called "death-CHIP," to map the immediate early antiapoptotic gene expression profile of cytokine-activated islets. Though later changes in islet gene expression after cytokine activation have been mapped in a number of studies (14,15), we focused only on the immediate early response, as it is this response that determines cell fate after inflammatory insult (1619). Surprisingly, we found that in contrast to other cell types, primary islets have a highly restricted immediate early antiapoptotic gene response, with TNFAIP3/A20 being the most highly regulated antiapoptotic gene. Significantly, we demonstrate that A20 is regulated at the level of gene transcription in pancreatic -cells by the proinflammatory transcription factor nuclear factor-B (NF-B), thus linking islet inflammatory gene responses with protection from apoptosis. Together, with our previous studies demonstrating an anti-inflammatory and antiapoptotic function for A20 (13,2022), these present data indicate that A20 is a critical component of the islet-regulated response to inflammatory stress and injury. Thus, we demonstrate that loss of A20 expression renders -cells susceptible to apoptotic death; conversely, enhancing A20 expression in -cells may improve their survival in the face of inflammatory and autoimmune insults (13,21).

    RESEARCH DESIGN AND METHODS

    BALB/c and C57BL/6 mice were purchased from ARC (Perth, WA, Australia). NOD mice were purchased from The Walter and Eliza Hall Institute (Melbourne, VIC, Australia). Procedures complied with the Australian Code of Practice for the Care and Use of Animals for Scientific Purposes.

    Cell death assays.

    Assays were performed using a modified crystal violet method (23,24). Briefly, -insulinoma (-TC3) cells were pretreated (30 min) with 0.01 μmol/l actinomycin D (Calbiochem, Kilsyth, Australia) before the addition of 100, 500, or 1000 units/ml of recombinant mouse tumor necrosis factor (TNF)- (R&D Systems, Minneapolis, MN). Twenty-four hours later, cell death was determined as described (23).

    Cytokine stimulation.

    Human primary islets, provided by Prof. Phillip O’Connell (Westmead Hospital, Sydney, NSW, Australia), were isolated from cadaveric organ donors and cultured as described (25). Mouse islets were isolated and cultured as we have described (13,26). For cytokine stimulation, islets (150200 islets/treatment) were stimulated with 200 units/ml of the appropriate cytokine for the indicated times. Human and mouse recombinant T-helper (Th) 1 cytokines interleukin (IL)-1, TNF-, or -interferon (IFN), and the Th2 cytokines IL-4, IL-13, or IL-15 (R&D Systems). -TC3 and Min6 cells were cultured as described (27). Cells were stimulated with 200 units/ml of mouse recombinant IL-1 or TNF- for the indicated time points. In some cases islets were first pretreated with 100 μmol/l of the pharmacological NF-B inhibitor, pyrrolidine dithiocarbamate (Sigma, St. Louis, MO) as described (28).

    Gene expression in -cells sorted with a fluorescence-activated cell sorter.

    For cell sorting, primary mouse islets were first stimulated with cytokines as above and then washed (4% EDTA-PBS), and dispersed into single cells by a brief incubation with 0.05% trypsin-EDTA (Invitrogen). Dispersed islets were then washed free of trypsin and resuspended in 1% BSA-PBS and sorted in a fluorescence-activated cell sorter (FACS) based upon autofluorescence (FL-1) as described (29). Sorted cells were then analyzed for A20 expression as described below. The percentage of insulin-positive -cells in the FL-1Hi and FL-1Lo sorted populations was determined by insulin (mouse anti-insulin; Zymed Laboratories, South San Francisco, CA) and glucagon (rabbit anti-glucagon; ICN Immunologicals, Lisle, IL) specific labeling on cytospun cells.

    Real-time PCR.

    mRNA was extracted as described (26); we obtained 35 μg mRNA per 200 islets. cDNA was produced from 0.5 μg of RNA using the SuperScript III Reverse Transcriptase Kit (Invitrogen, Australia). Reactions were performed on the RG300 Real Time PCR System (Rotorgene), using SYBR green chemistry (JumpStart, Sigma, Castle Hill, Australia). A20 primers were human (F: AAAGCCCTCATCGACAGAAA; R: CAGTTGCCAGCGGAATTTA) and mouse (F: TGGTTCCAATTTTGCTCCTT; R: CGTTGATCAGGTGAGTCGTG). Human and mouse samples were normalized with glyceraldehyde-3-phosphate dehydrogenase (F: CACATCAAGAAGGTGGTG; R: TGTCATACCAGGAAATGA) or CPH2, respectively (F: TGGACCAAACACAAACGGTTCC; R: ACATTGCGAGCAGATGGGGTAG). Fold change was calculated following the 2CT method.

    Microarray.

    Before hybridization, total RNA was amplified and labeled using the MessageAmp II aRNA Amplification Kit (Ambion, Austin, TX). Amplified RNA quality was evaluated by capillary electrophoresis using an Agilent 2100 Bioanalyzer (Agilent Technologies, Palo Alto, CA). Samples were hybridized on a custom-designed death-CHIP, a CustomArray 12K-Microarray platform (CombiMatrix, Mukilteo, WA). Genes were selected for inclusion on the microarray based upon their reported role in the regulation of cell death (Table 1). The microarray probe design and feature layout, hybridization and scanning protocol, data normalization, and quality control data will be reported elsewhere (D. Liuwantara, S.T. Grey, unpublished data). All data were first normalized and background corrected, then log (base 2) transformed. For each experiment, islets were isolated from 10 mice, pooled, and treated with cytokines, and RNA was harvested as described. Each experiment was performed on three (NOD) or four (BALB/c) independent islet preparations. All samples were run on duplicate arrays; 42 arrays were run in total. The mean coefficients of variation (CVs) based on replicate features on the microarrays were 20%.

    Transfection and reporter assay.

    Transfection of -TC3 cells, luciferase, and -galactosidase (-gal) activity was performed as described (21). The A20 reporter constructs were a kind gift of Dr. R. Dikstein (The Weizmann Institute of Science, Rehovot, Israel) (30). The expression plasmids encoding Fas-associated death domain (FADD), TNF receptorassociated factor (TRAF) 2, TRAF6, NF-Binducing kinase (NIK), P65, and protein kinase D (PKD) have been described (22,31,32). All data are expressed as relative light activity (21).

    Islet transplantation.

    Islet transplantation into diabetic (blood glucose 300 mg/dl) recipients was performed essentially as described (13). Islets (isolated from three donor mice per recipient) from BALB/c mice were transplanted either into diabetic BALB/c recipients (syngeneic model) or into diabetic C57BL/6 mice (allogeneic model). To harvest the transplanted islets, nephrectomy was performed on postoperative day 5. The islet graft was collected by carefully peeling off the kidney capsule; mRNA was then isolated as described above. In some cases the graft was prepared for histological assessment as described (13).

    RESULTS

    -Cells have an inducible antiapoptotic response.

    Despite the importance of cell death in pathological -cell loss, little is known about the genetic control of apoptosis in these cells. Cell death is a highly regulated event, controlled in a proinflammatory setting by an inducible set of antiapoptotic genes rapidly upregulated in response to this same inflammatory stress and/or injury (1619). We were particularly interested in determining whether -cells could also generate a rapid and inducible antiapoptotic response after exposure to inflammatory cytokines as has been described for other cell types (1618). We first tested this concept by stimulating -TC3 cells with TNF- in the presence or absence of the general transcription inhibitor, actinomycin D. Blockade of de novo gene transcription in combination with TNF- stimulation sensitized -TC3 cells to cell death, whereas either treatment alone had minimal effect upon cell survival (Fig. 1). Cell survival decreased from 100% in control cells to 53% when cells were treated with 1000 units of TNF- and actinomycin D (P  0.005). These data demonstrate that blockade of de novo gene transcription sensitizes -cells to TNF-induced cell death, consistent with the notion that TNF- triggers a proapoptotic death cascade that can be prevented by gene induction (1618). Thus, -cells do have a cytokine-dependent regulated antiapoptotic response as has been demonstrated for other cell types.

    Islets exhibit a limited immediate early antiapoptotic gene response.

    Having established that -cells do have an inducible protective response, we next determined the molecular basis of this response. We used a custom-designed microarray (death-CHIP) to analyze the immediate early antiapoptotic gene response of primary rodent islets. Antiapoptotic genes from all known and putative antiapoptotic gene families were included on the death-CHIP (Table 1). cRNA was prepared from islets isolated from nondiabetic-prone BALB/c mice or diabetic-prone NOD mice. For each islet preparation, islets were either left untreated or stimulated with IL-1 or TNF- for 1 h. These cytokines were chosen based on their established roles in inducing -cell apoptosis both in vitro (21,33,34) and in vivo (3537).

    Of the 63 antiapoptotic genes represented on the death-CHIP, we found that islets constitutively expressed a broad selection of antiapoptotic genes over a range of expression levels (Table 1). To confirm the findings of the death-CHIP, the basal expression of selected genes (Table 1) was established by Western blot and/or PCR analysis in primary human and rodent islets and -insulinoma cell lines (data not shown). Of the genes confirmed to be expressed in all three tissue samples, highly expressed genes (10,000 mean intensity units) including heat shock protein 70, HSPA1A/HSP70, and SOD1/CuZnSOD; moderately expressed genes (110,000 mean intensity units) including Heme oxygenase 1 and SOD2/MnSOD; and genes including the cellular inhibitors of apoptosis, BIRC2/c-IAP1, BIRC3/c-IAP2, BIRC4/XIAP, and the BCL family genes BCL2, BCL2L1/BCLXL, BCL2A1A/Bfl-1/A1, and TNFAIP3/A20 were expressed at relatively low constitutive basal levels (1,000 mean intensity units). In contrast, examination of the expression profile after cytokine stimulation indicated that islets have a relatively sparse immediate early antiapoptotic gene response (Fig. 2A and B). Establishing a twofold cutoff for statistical significance, only two genes were determined to be upregulated, namely, TNFAIP3/A20 and BIRC3/c-IAP-2, of which A20 was consistently the most highly regulated antiapoptotic gene (Fig. 2C). These data contrast islets with other tissues such as endothelial cells, which express a broad range of antiapoptotic genes under similar conditions (19,38,39).

    Regulation of A20 in rodent islets.

    As A20 was the most highly regulated immediate early antiapoptotic gene in islets, we focused on its regulation in more detail. Primary islets isolated from BALB/c or NOD mice were stimulated with the cytokines IL-1 or TNF- for 18 h, and steady- state mRNA expression was analyzed by PCR. As shown in Fig. 3A, A20 was expression was markedly upregulated by 23-fold (P  0.005) and 16-fold (P  0.001) in BALB/c and NOD islets, respectively, within 1 h after IL-1 stimulation. Kinetic analysis of A20 expression revealed that although the expression declined thereafter, it was still maintained at significant levels. Thus, A20 is a cytokine-inducible immediate early response gene in islets, consistent with its regulation in other cell types (40). In comparison with IL-1, TNF- was a relatively poor inducer of A20 expression, stimulating only an approximately fourfold increase in A20 mRNA expression at 1 h for islets isolated from either BALB/c or NOD mice (P  0.05). This finding may relate to differential activation of NF-B family members by IL-1 versus TNF-, respectively, which can then lead to distinct patterns of gene expression (41). The poor induction of A20 by TNF- is interesting, given the fact that TNF- is one of the earliest -celltoxic cytokines detected in the islet infiltrate during the development of type 1 diabetes in NOD mice (36). However, Fig. 3B shows that there was no difference in A20 expression between the male and female NOD mice, demonstrating that the lower disease incidence in the male NOD mice is not associated with A20 expression.

    Regulation of A20 in human islets.

    We next examined A20 regulation in primary human islets. As shown in Fig. 3C, A20 mRNA expression was rapidly induced after IL-1 stimulation, reaching a maximal 25-fold induction at 1 h after stimulation and decreasing thereafter. Again IL-1 was a more potent inducer of A20 expression than TNF-. In contrast with IL-1 and TNF-, other Th1-type cytokines such as -IFN and IL-15 and the Th2-type cytokines IL-4 and IL-13 did not induce A20 expression in human or rodent islets (data not shown). Together, these data demonstrate that A20 is an immediate early response gene in both human and rodent islets, preferentially regulated by the Th1-type cytokines, IL-1 and TNF-.

    -Cellspecific expression of A20 in islets.

    Islets of Langerhans are a heterogeneous tissue comprising not only insulin-secreting -cells but also additional hormone-secreting cells including - and -cells. -Cells from freshly isolated islets are autofluorescent due to intracellular flavin adenine dinucleotide levels and can be FACS-purified on this basis (29). To determine the cellular source of A20 expression in intact primary islets, we next examined A20 expression in FACS-purified primary -cells and non-cells (Fig. 4A). We found that inducible A20 expression was restricted to insulin-positive -cells (approximately threefold induction P  0.05) as A20 expression was not induced by IL-1 in glucagon-positive cells (Fig. 4B). We also examined inducible A20 expression in the insulinoma cell line, Min6. Stimulation of Min6 cells with IL-1 or TNF- resulted in a rapid and marked induction of A20, with kinetics similar to that seen for primary human and rodent islets (Fig. 4C). Thus, these data demonstrate -cellspecific regulation of A20 expression within pancreatic islets.

    Cytokine-dependent regulation of A20 requires de novo gene transcription.

    We next began to address the mechanism(s) by which A20 was regulated in islets. Primary rodent islets were pretreated with actinomycin D to block de novo gene transcription and then stimulated with IL-1 for 1 h. Analysis of A20 steady-state mRNA revealed that induction of A20 was completely abolished (>90%, P  0.001) by actinomycin D treatment, indicating that in islets, cytokine-dependent induction of A20 is regulated at the level of de novo gene transcription (Fig. 5A). To confirm that A20 was regulated at the level of transcription, -TC3 cells were transfected with an A20 promoter sequence upstream of a luciferase reporter and stimulated with IL-1 or TNF-. As shown in Fig. 5C, IL-1 and TNF- induced approximately fourfold (P  0.001) and approximately twofold (P  0.01) increases in luciferase activity, respectively. Together these data demonstrate that A20 is regulated at the level of gene transcription in -cells, and prevention of A20 expression by inhibition of gene transcription correlated with sensitization to TNF-induced apoptosis.

    NF-B is both necessary and sufficient to initiate transcriptional activation of the A20 promoter.

    A20 has been described previously to be an NF-B target gene and contains two NF-B binding sequences in its promoter region (42). To determine whether or not the induction of A20 transcription in -cells is NF-B dependent, we transfected -TC3 cells with an A20 promoter construct in which the two NF-B binding sites were deleted (NF-B) (Fig. 5B) and examined its activation in response to either IL-1 or TNF-. As shown in Fig. 5C, compared with the wild-type promoter, both the cytokine-dependent and constitutive A20 promoter activities were completely abrogated (P  0.001) in the NF-Bdeleted reporter.

    We next utilized an alternative approach to confirm the importance of NF-B in the regulation of de novo transcription of the A20 promoter. We achieved this by overexpressing the p65/RelA subunit of NF-B (39) in -TC3 cells and examined whether this change would result in induction of the A20 promoter. As shown in Fig. 6B, forced expression of p65/RelA resulted in a marked dose-dependent activation of the A20 promoter, showing an 19-fold increase (P  0.001) at the highest concentration tested. Importantly, forced expression of p65/RelA also resulted in a fivefold induction (P  0.005) in endogenous A20 mRNA levels, indicating that NF-B was sufficient to drive the endogenous A20 promoter (Fig. 6A). Finally, inhibition of NF-kB activity using the chemical inhibitor, pyrrolidine dithiocarbamate (28), abolished IL-1stimulated A20 mRNA (>90%, P  0.01) expression in islets (Fig. 6C.) Together these data demonstrate that NF-B is both necessary and sufficient to initiate transcriptional activation of the A20 promoter and drive expression of A20 mRNA. These data are consistent with our finding that A20 is regulated by the NF-Bactivating cytokines IL-1 and TNF-, but not cytokines such as -IFN, IL-4, IL-13, and IL-15, which do not activate NF-B.

    A20 transcription is regulated by multiple NF-B signaling pathways.

    NF-B constitutes a family of transcription factors that together act as major integrators of the cellular inflammatory response (39,43). Activation of discrete NF-B pathways through the Toll-like receptors (TLRs) or TNR receptors (TNF-Rs) or via free radicals results in the induction of a distinct sets of genes (39,41,44). To determine the important NF-B pathways regulating A20 expression in -cells, we utilized a transient transfection approach, cotransfecting -TC3 cells with the A20 reporter and specific kinases or adapter proteins, known to activate distinct NF-B signaling pathways. TRAF6 is an adaptor protein required for NF-B signaling through the TLR family, whereas TRAF2 mediates NF-B signaling through the TNF-R family. As shown in Fig. 7A and B, forced expression of either TRAF6 or TRAF2 dose dependently activated the A20 promoter with 9-fold (P  0.001) and 6.5-fold (P  0.001) increases in reporter activity at the highest concentrations used, respectively. Thus, we demonstrate that A20 is a downstream target gene of the canonical NF-B pathway, activated via ligation of TLR and TNF-R families. These data are consistent with our experiments demonstrating that increased A20 expression in IL-1(TLR-activating) and TNF-(TNF-Ractivating) stimulated -cells.

    We next addressed whether A20 would be regulated in response to the noncanonical and free radicaldependent pathways. NIK is critical for mediating signaling through the noncanonical TNF-R pathway (39), whereas free radicals activate NF-B through a PKD-dependent signaling pathway (44). To determine whether A20 is a target gene of these pathways, we cotransfected -TC3 cells with the A20 promoter and either NIK or PKD (Fig. 7C and D). Forced expression of NIK resulted in an 3.6-fold (P  0.005) activation of the A20 promoter, whereas PKD induced a more modest 2.6-fold (P  0.001) induction of reporter activity. These data demonstrate that A20 transcription can be induced by TNF-Rs that activate the noncanonical pathway and by free radicals. Together our data identify A20 as a major NF-B target gene regulated by diverse NF-B signaling pathways.

    Expression of A20 in stressed islets in vivo.

    Transplanted islets are exposed to a hyperglycemic environment, nonspecific inflammatory reactions (i.e., including cytokines and free radicals), and immune-mediated rejection as well as stresses relating to hypoxia and lack of adequate nutrients (10,11). Many of these factors are able to induce NF-B. Having identified A20 as a major NF-Bregulated gene in -cells, we hypothesized that A20 expression should be heavily regulated in islets in vivo after exposure to inflammatory stress. To assess this directly, we examined A20 expression levels in islets after transplantation into either diabetic syngeneic or diabetic allogeneic hosts. As shown in Fig. 8, already at day 5 after transplantation, there were significant approximately threefold (P  0.05) and approximately fourfold (P  0.05) increases in A20 steady-state mRNA expression in islets transplanted into either syngeneic or allogeneic recipients, respectively. These data demonstrate that transplanted islets do have a regulated antiapoptotic stress response and that A20 is a critical component of this stress response in vivo.

    A20 is sufficient to protect -cells from TNF-induced cell death.

    We demonstrated that blocking de novo gene transcription sensitizes -cells to apoptosis and prevents A20 upregulation, indicating that loss of A20 expression may be partly responsible for the sensitization to TNF-induced apoptosis. To determine the importance of A20 in regulating -cell apoptosis, we next asked whether A20 expression was sufficient to protect -cells from TNF-induced apoptosis.

    Activation of the TNF receptor by its cognate ligand results in the recruitment of FADD, which subsequently recruits and activates procaspase 8/FLICE, triggering apoptosis (1,39). For this experiment, -TC3 cells were transiently cotransfected with a FADD expression vector to induce apoptosis in the presence or absence of an A20 expression plasmid. Controls cells were transfected with a vector expressing a FADD dominant negative inhibitor (FADD-DN) or the empty vector pcDNA3. All groups were transiently cotransfected with a cytomegalovirus-driven -gal reporter, which was used to determine the percentage of viable cells for each group (22). As shown in Fig. 9, forced expression of FADD resulted in the rapid destruction of -TC3 cells as evidenced by the decrease in -gal reporter activity (60%, P  0.005) compared with baseline levels observed in control groups (e.g., pcDNA3 or FADD-DN), whereas expression of FADD-DN had little effect upon cell viability (P = 0.132). In contrast, A20 expressing cells were completely protected from the proapoptotic effect of FADD (P  0.05). These data demonstrate for the first time that A20 is sufficient to protect -cells from TNF-induced apoptosis; thus, loss of A20 expression by transcriptional blockade sensitizes -cells to apoptotic cell death.

    DISCUSSION

    Apoptotic -cell death is an important pathological mechanism of -cell loss in type 1 diabetes and islet graft rejection (5,6). Apoptosis is a highly regulated process, such that the decision to undergo apoptosis is dependent upon the balance between antiapoptotic and proapoptotic signals (19). In an inflammatory setting, cells are required to express a new or inducible set of antiapoptotic genes as a mechanism to counteract the physiological stresses that otherwise lead to cellular damage and apoptosis (19,39). Blockade of this regulated antiapoptotic response sensitizes many cell types to apoptotic death, underscoring the physiological relevance of this signaling network in cell biology (1618).

    In this present study we demonstrate that this paradigm is true for -cells, as -cells were sensitized to TNF-induced death by inhibition of de novo gene transcription. Our microarray-based approach revealed that TNFAIP3/A20 is one potential candidate gene providing a molecular basis for this protective response. A20 is a zinc fingercontaining, immediate early-response gene with a potent antiapoptotic and anti-inflammatory function (20,40,45). This essential antiapoptotic and anti-inflammatory function of A20 is preserved in islets (13,21). Once expressed, A20 binds to and targets TNF receptor interacting protein for proteosomal degradation, thereby preventing TNF-induced NF-B activation (46). The antiapoptotic mechanism of A20 is less well understood but may also involve inhibition of key proximal signaling events, as A20 inhibits activation of initiator caspases after death receptor ligation (22), consistent with our data demonstrating that A20 protects -cells from FADD-induced apoptosis.

    The transcription factor NF-B regulates multiple proinflammatory genes that can contribute to islet destruction. NF-B can promote T-cellmediated killing and the generation of -cell toxins through the induction of molecules such as Fas (47,48), inducible nitric oxide synthase (48,49) and cyclooxygenase-2 (50), respectively. In addition, the promoters of other proinflammatory genes induced in -cells, including chemokines (i.e., monocyte chemoattractant protein-1) and adhesion molecules (i.e., intercellular adhesion molecule-1), also possess binding elements for NF-B (43). The importance of NF-B in -cell inflammatory responses is underscored by the fact that blockade of NF-B in in vitro models, by means of an inhibitor of NFB (IB) super-repressor or via A20 overexpression, prevents IL-1and -IFNinduced -cell dysfunction and death (21,48,49,51). Collectively these data implicate NF-B as a major player in cytokine-dependent -cell dysfunction and indicate that targeting NF-B may have therapeutic utility as a means to improve islet function in the face of inflammatory insults.

    However, aside from its important proinflammatory role, NF-B is a major regulator of cellular apoptosis through its ability to control the expression of multiple antiapoptotic genes including the c-IAPs, caspase-8-c-FLIP, Bfl-1/A1 (39), and A20 (20,42). In cells that lack the NF-B family member p65/RelA, exposure to TNF- will induce apoptosis (16). Furthermore, blockade of NF-B activation, by nonspecifically inhibiting transcription with actinomycin D (52) or specifically via the use of an IB super-repressor (17,18), also sensitizes cells to TNF-mediated apoptosis. Importantly blockade of NF-B in -cells by means of an IB super-repressor (53) or via actinomycin D as we demonstrate here, also sensitizes cells to TNF-dependent apoptotic death. We propose that this sensitization was due to blockade of NF-B activation and, at least in part, the subsequent loss of A20 expression. Consistent with this, prevention of A20 induction in vitro sensitizes endothelial cells to TNF-dependent apoptosis (20). Thus in -cells, as has been demonstrated for other cell types, NF-B activation governs both proinflammatory responses and protection from apoptosis (39). Therefore, targeting NF-B activation in an in vivo setting in which multiple factors are at play may sensitize -cells to apoptosis (53). In light of this, we propose that more sophisticated approaches than mere blanket blockade of NF-B are warranted if one aims to prevent the unwanted proinflammatory effects of NF-B activation without incurring the associated risk of sensitizing -cells to apoptotic death. Alternative strategies might include expressing genes such as A20 (13,20) or targeting specific upstream regulators of NF-B activation (54).

    In conclusion, we demonstrate that primary islets upregulated a relatively small set of antiapoptotic genes in response to inflammatory stress, of which TNFAIP3/A20 was the most highly regulated. Here we demonstrate that A20 is regulated at the level of gene transcription in pancreatic -cells, under the control of the transcription factor NF-B; thus, tightly linking islet proinflammatory gene responses with protection from apoptosis. Together with our previous studies demonstrating an anti-inflammatory and antiapoptotic function for A20 in islets (13,21), these present data indicate that A20 is a critical component of the islet-regulated response to inflammatory stress and injury. Thus, pathologic loss of A20 expression may render -cells susceptible to apoptotic death; conversely, enhancing A20 expression in -cells may improve their survival in the face of inflammatory and autoimmune insults. Importantly, our data indicate that blockade of NF-B, as a means to prevent islet inflammatory responses in vivo, may have the unwanted side effect of sensitizing -cells to apoptosis by preventing the upregulation of antiapoptotic genes such as A20 (16,17,20).

    ACKNOWLEDGMENTS

    This work was supported by the Juvenile Diabetes Foundation International (JDRF 2-2000-719) and a BioFirst Award from the New South Wales Ministry for Science and Medical Research (to S.T.G.).

    The authors thank Drs. J. Gunton and R. Laybutt for critical reading of this manuscript and T. Shukri, L. Choi, J. Chan, Jerome Darakdjian, and the Biological Testing Facility staff for technical assistance.

    FOOTNOTES

    The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

    REFERENCES

    Green DR: Apoptotic pathways: the roads to ruin. Cell 94:695698, 1998

    Vaux DL, Haecker G, Strasser A: An evolutionary perspective on apoptosis (Review). Cell 76:777779, 1994

    Scaglia L, Cahill CJ, Finegood DT, Bonner-Weir S: Apoptosis participates in the remodeling of the endocrine pancreas in the neonatal rat. Endocrinology 138:17361741, 1997

    Scaglia L, Smith FE, Bonner-Weir S: Apoptosis contributes to the involution of beta cell mass in the post partum rat pancreas. Endocrinology 136:54615468, 1995

    Mathis D, Vence L, Benoist C: Beta-cell death during progression to diabetes. Nature 414:792798, 2001

    Cnop M, Welsh N, Jonas JC, Jorns A, Lenzen S, Eizirik DL: Mechanisms of pancreatic -cell death in type 1 and type 2 diabetes: many differences, few similarities. Diabetes 54 (Suppl. 2):S97S107, 2005

    Delovitch TL, Singh B: The nonobese diabetic mouse as a model of autoimmune diabetes: immune dysregulation gets the NOD. Immunity 7:727738, 1997 [Erratum in Immunity 8:531, 1998]

    Tisch R, McDevitt H: Insulin-dependent diabetes mellitus. Cell 85:291297, 1996

    Corbett JA, Kwon G, Marino MH, Rodi CP, Sullivan PM, Turk J, McDaniel ML: Tyrosine kinase inhibitors prevent cytokine-induced expression of iNOS and COX-2 by human islets. Am J Physiol 270:C1581C1587, 1996

    Ricordi C, Strom TB: Clinical islet transplantation: advances and immunological challenges. Nat Rev Immunol 4:259268, 2004

    Lechler RI, Garden OA, Turka LA: The complementary roles of deletion and regulation in transplantation tolerance. Nat Rev Immunol 3:147158, 2003

    Weir GC, Bonner-Weir S: Scientific and political impediments to successful islet transplantation. Diabetes 46:12471256, 1997

    Grey ST, Longo C, Shukri T, Patel VI, Csizmadia E, Daniel S, Arvelo MB, Tchipashvili V, Ferran C: Genetic engineering of a suboptimal islet graft with A20 preserves beta cell mass and function. J Immunol 170:62506256, 2003

    Cardozo AK, Kruhoffer M, Leeman R, Orntoft T, Eizirik DL: Identification of novel cytokine-induced genes in pancreatic -cells by high-density oligonucleotide arrays. Diabetes 50:909920, 2001

    Cardozo AK, Heimberg H, Heremans Y, Leeman R, Kutlu B, Kruhoffer M, Orntoft T, Eizirik DL: A comprehensive analysis of cytokine-induced and nuclear factor-kappa B-dependent genes in primary rat pancreatic beta-cells. J Biol Chem 276:4887948886, 2001

    Beg AA, Baltimore D: An essential role for NF-kappaB in preventing TNF-alpha-induced cell death. Science 274:782784, 1996

    Van Antwerp DJ, Martin SJ, Kafri T, Green DR, Verma IM: Suppression of TNF-alpha-induced apoptosis by NF-kappaB. Science 274:787789, 1996

    Wang CY, Mayo MW, Baldwin AS Jr: TNF- and cancer therapy-induced apoptosis: potentiation by inhibition of NF-kappaB. Science 274:784787, 1996

    Bach FH, Hancock WW, Ferran C: Protective genes expressed in endothelial cells: a regulatory response to injury. Immunol Today 18:483486, 1997

    Ferran C, Stroka DM, Badrichani AZ, Cooper JT, Wrighton CJ, Soares M, Grey ST, Bach FH: A20 inhibits NF-kappaB activation in endothelial cells without sensitizing to tumor necrosis factor-mediated apoptosis. Blood 91:22492258, 1998

    Grey ST, Arvelo MB, Hasenkamp W, Bach FH, Ferran C: A20 inhibits cytokine-induced apoptosis and nuclear factor kappaB- dependent gene activation in islets. J Exp Med 190:11351146, 1999

    Daniel S, Arvelo MB, Patel VI, Longo CR, Shrikhande G, Shukri T, Mahiou J, Sun DW, Mottley C, Grey ST, Ferran C: A20 protects endothelial cells from TNF-, Fas-, and NK-mediated cell death by inhibiting caspase 8 activation. Blood 104:23762384, 2004

    Grey ST, Tsuchida A, Hau H, Orthner CL, Salem HH, Hancock WW: Selective inhibitory effects of the anticoagulant activated protein C on the responses of human mononuclear phagocytes to LPS, IFN-gamma, or phorbol ester. J Immunol 153:36643672, 1994

    Gunther L, Berberat PO, Haga M, Brouard S, Smith RN, Soares MP, Bach FH, Tobiasch E: Carbon monoxide protects pancreatic -cells from apoptosis and improves islet function/survival after transplantation. Diabetes 51:994999, 2002

    Gunton JE, Kulkarni RN, Yim S, Okada T, Hawthorne WJ, Tseng YH, Roberson RS, Ricordi C, O’Connell P J, Gonzalez FJ, Kahn CR: Loss of ARNT/HIF1beta mediates altered gene expression and pancreatic-islet dysfunction in human type 2 diabetes. Cell 122:337349, 2005

    Krauss S, Zhang CY, Scorrano L, Dalgaard LT, St-Pierre J, Grey ST, Lowell BB: Superoxide-mediated activation of uncoupling protein 2 causes pancreatic beta cell dysfunction. J Clin Invest 112:18311842, 2003

    D’Ambra R, Surana M, Efrat S, Starr RG, Fleischer N: Regulation of insulin secretion from beta-cell lines derived from transgenic mice insulinomas resembles that of normal beta-cells. Endocrinology 126:28152822, 1990

    Kwon G, Corbett JA, Rodi CP, Sullivan P, McDaniel ML: Interleukin-1 beta-induced nitric oxide synthase expression by rat pancreatic beta-cells: evidence for the involvement of nuclear factor kappa B in the signaling mechanism. Endocrinology 136:47904795, 1995

    Pipeleers DG, in’t Veld PA, Van de Winkel M, Maes E, Schuit FC, Gepts W: A new in vitro model for the study of pancreatic A and B cells. Endocrinology 117:806816, 1985

    Ainbinder E, Revach M, Wolstein O, Moshonov S, Diamant N, Dikstein R: Mechanism of rapid transcriptional induction of tumor necrosis factor alpha-responsive genes by NF-kappaB. Mol Cell Biol 22:63546362, 2002

    Anrather J, Csizmadia V, Brostjan C, Soares MP, Bach FH, Winkler H: Inhibition of bovine endothelial cell activation in vitro by regulated expression of a transdominant inhibitor of NF-kappa B. J Clin Invest 99:763772, 1997

    Storz P, Doppler H, Ferran C, Grey ST, Toker A: Functional dichotomy of A20 in apoptotic and necrotic cell death. Biochem J 387:4755, 2005

    Arnush M, Heitmeier MR, Scarim AL, Marino MH, Manning PT, Corbett JA: IL-1 produced and released endogenously within human islets inhibits beta cell function. J Clin Invest 102:516526, 1998

    Cetkovic-Cvrlje M, Eizirik DL: TNF-alpha and IFN-gamma potentiate the deleterious effects of IL-1 beta on mouse pancreatic islets mainly via generation of nitric oxide. Cytokine 6:399406, 1994

    Thomas HE, Irawaty W, Darwiche R, Brodnicki TC, Santamaria P, Allison J, Kay TW: IL-1 receptor deficiency slows progression to diabetes in the NOD mouse. Diabetes 53:113121, 2004

    Dahlen E, Dawe K, Ohlsson L, Hedlund G: Dendritic cells and macrophages are the first and major producers of TNF-alpha in pancreatic islets in the nonobese diabetic mouse. J Immunol 160:35853593, 1998

    Pakala SV, Chivetta M, Kelly CB, Katz JD: In autoimmune diabetes the transition from benign to pernicious insulitis requires an islet cell response to tumor necrosis factor alpha. J Exp Med 189:10531062, 1999

    Brouard S, Berberat PO, Tobiasch E, Seldon MP, Bach FH, Soares MP: Heme oxygenase-1-derived carbon monoxide requires the activation of transcription factor NF-kappa B to protect endothelial cells from tumor necrosis factor-alpha-mediated apoptosis. J Biol Chem 277:1795017961, 2002

    Karin M, Lin A: NF-kappaB at the crossroads of life and death. Nat Immunol 3:221227, 2002

    Opipari AW Jr, Boguski MS, Dixit VM: The A20 cDNA induced by tumor necrosis factor alpha encodes a novel type of zinc finger protein. J Bio Chem 265:1470514708, 1990

    Werner SL, Barken D, Hoffmann A: Stimulus specificity of gene expression programs determined by temporal control of IKK activity. Science 309:18571861, 2005

    Krikos A, Laherty CD, Dixit VM: Transcriptional activation of the tumor necrosis factor alpha-inducible zinc finger protein, A20, is mediated by kappa B elements. J Bio Chem 267:1797117976, 1992

    May MJ, Ghosh S: Signal transduction through NF-kappa B. Immunol Today 19:8088, 1998

    Storz P, Toker A: Protein kinase D mediates a stress-induced NF-kappaB activation and survival pathway. EMBO J 22:109120, 2003

    Lee EG, Boone DL, Chai S, Libby SL, Chien M, Lodolce JP, Ma A: Failure to regulate TNF-induced NF-kappaB and cell death responses in A20-deficient mice. Science 289:23502354., 2000

    Wertz IE, O’Rourke KM, Zhou H, Eby M, Aravind L, Seshagiri S, Wu P, Wiesmann C, Baker R, Boone DL, Ma A, Koonin EV, Dixit VM: De-ubiquitination and ubiquitin ligase domains of A20 downregulate NF-kappaB signalling. Nature 430:694699, 2004

    Darville MI, Eizirik DL: Cytokine induction of Fas gene expression in insulin-producing cells requires the transcription factors NF-B and C/EBP. Diabetes 50:17411748, 2001

    Heimberg H, Heremans Y, Jobin C, Leemans R, Cardozo AK, Darville M, Eizirik DL: Inhibition of cytokine-induced NF-B activation by adenovirus-mediated expression of a NF-B super-repressor prevents -cell apoptosis. Diabetes 50:22192224, 2001

    Kwon G, Corbett JA, Hauser S, Hill JR, Turk J, McDaniel ML: Evidence for involvement of the proteasome complex (26S) and NFB in IL-1induced nitric oxide and prostaglandin production by rat islets and RINm5F cells. Diabetes 47:583591, 1998

    Sorli CH, Zhang HJ, Armstrong MB, Rajotte RV, Maclouf J, Robertson RP: Basal expression of cyclooxygenase-2 and nuclear factor-interleukin 6 are dominant and coordinately regulated by interleukin 1 in the pancreatic islet. Proc Natl Acad Sci U S A 95:17881793, 1998

    Giannoukakis N, Rudert WA, Trucco M, Robbins PD: Protection of human islets from the effects of interleukin-1beta by adenoviral gene transfer of an Ikappa B repressor. J Biol Chem 275:3650936513, 2000

    Wong GH, Elwell JH, Oberley LW, Goeddel DV: Manganous superoxide dismutase is essential for cellular resistance to cytotoxicity of tumor necrosis factor. Cell 58:923931, 1989

    Chang I, Kim S, Kim JY, Cho N, Kim YH, Kim HS, Lee MK, Kim KW, Lee MS: Nuclear factor B protects pancreatic -cells from tumor necrosis factor-mediated apoptosis. Diabetes 52:11691175, 2003

    Giannoukakis N, Rudert WA, Ghivizzani SC, Gambotto A, Ricordi C, Trucco M, Robbins PD: Adenoviral gene transfer of the interleukin-1 receptor antagonist protein to human islets prevents IL-1induced -cell impairment and activation of islet cell apoptosis in vitro. Diabetes 48:17301736, 1999

  订阅登记:

请您在下面输入常用的Email地址、职业以便我们定期通过邮箱发送给您最新的相关医学信息,感谢您浏览首席医学网!

邮箱:    职业: