首席网期刊频道
您所在位置: 首页 > 期刊 > 过刊浏览 > 基础医学与生物医学工程> 《免疫学杂志》> 2007年4月178卷8期>文章精华> 文章详情

A Critical Role for p in the Control of NF-B-Dependent Gene Expression in TLR-Stimulated Dendritic Cells Exposed to Genistein

首席医学网      2008年05月25日 22:44:13 Sunday  
 

作者:Nathalie Dijsselbloem, Stanislas Goriely, Valentina Albarani, Sarah Gerlo, Sarah Francoz, Jean-Christophe Marine, Michel Goldman, Guy Haegeman* and Wim Vanden Berghe,    作者单位:* Laboratory for Eukaryotic Gene Expression and Signal Transduction (LEGEST), Molecular Biology, Ghent University, Ghent, Belgium; Institute for Medical Immunology, Faculty of Medecine, Free University of Brussels, Charleroi-Gosselies, Belgium; Laboratory for Molecular Cancer Biology, Department f

  加入收藏夹

【摘要】  Considerable research has focused on the anti-inflammatory and antiproliferative activities exhibited by the soy isoflavone genistein. We previously demonstrated that genistein suppresses TNF--induced NF-B-dependent IL-6 gene expression in cancer cells by interfering with the mitogen- and stress-activated protein kinase 1 activation pathway. However, effects of isoflavones on immune cells, such as dendritic cells, remain largely unknown. Here we show that genistein markedly reduces IL-6 cytokine production and transcription in LPS-stimulated human monocyte-derived dendritic cells. More particularly, we observe that genistein inhibits IL-6 gene expression by modulating the transcription factor NF-B. Examination of NF-B-related events downstream of TLR4 demonstrates that genistein affects NF-B subcellular localization and DNA binding, although we observe only a minor inhibitory impact of genistein on the classical LPS-induced signaling steps. Interestingly, we find that genistein significantly increases p53 protein levels. We also show that overexpression of p53 in TLR4/MD2 HEK293T cells blocks LPS-induced NF-B-dependent gene transcription, indicating the occurrence of functional cross-talk between p53 and NF-B. Moreover, analysis of IL-6 mRNA levels in bone marrow-derived p53 null vs wild-type dendritic cells confirms a role for p53 in the reduction of NF-B-dependent gene expression, mediated by genistein.

【关键词】  critical nf-b-dependent expression tlr-stimulated dendritic genistein



Introduction


Genistein belongs to the category of phenolic nonsteroidal isoflavonoids, which can mainly be found in soybeans and other plants of the Leguminosae family (1). Based on its phytoestrogen characteristic, genistein is pharmaceutically recommended as a dietary supplement for use in alternative hormone replacement therapy to relieve menopausal symptoms (2). Besides that, genistein behaves like an inhibitor of several enzymes or kinases (topoisomerase II, cAMP phosphodiesterase, Akt, tyrosine protein kinase), as an antioxidant due to its phenolic nature, and it affects a host of other intracellular processes (3). We have previously studied the molecular effects of genistein on the TNF--stimulated signal transduction toward IL-6 transcription in L2929sA fibroblasts and have shown that genistein affects the kinase cascade toward mitogen- and stress-activated protein kinase 1 (MSK1) activation, which accounts for NF-B p65 transactivation via serine 276 phosphorylation and for histone H3 serine 10 phosphorylation on the IL-6 promoter (4). Other research groups have demonstrated that isoflavones have inhibitory effects on classical NF-B activation (5, 6) and subsequently on NF-B-dependent antiapoptotic and inflammatory processes, which may contribute to their anticarcinogenic and anti-inflammatory properties. Potential inhibitory effects of genistein on the acquired immune system have been reported in some rodent studies, but the data are inconsistent and even conflicting (7). However, the role of genistein in modulating normal primary cells of the innate immune system and in particular its effect on dendritic cells (DC),3 have received little attention.


It is well established that DCs, as professional APCs of the innate immune system, reside at the host-pathogen interface and play a key role in directing adaptive immune responses by initializing T cell activity. When immature DCs are triggered by microbial compounds such as LPS, the expression of Ag-presenting MHC class II, accessory molecules and cytokines is up-regulated. Furthermore, depending on the DC maturation status and on the type of cytokines produced by the DC and by the environmental innate immune cells, naive CD4+ Th cells are instructed to differentiate into Th1, Th2 effector cells or regulatory T cells (8). The role of the prototype cytokines IL-12 and IL-4 in promoting respectively Th1- and Th2-polarized immune responses is well established (9, 10).


However, DC-derived IL-6 is postulated to influence the nature of the immune response too, as this cytokine induces the initial IL-4 production by naive T cells (11, 12). Even more recently is demonstrated that IL-6 shifts the TGF--driven regulatory T cell generation into pathogenic TH17 cell differentiation (13). Apart from this, IL-6 is involved in a myriad of cancer-, inflammation-, and immunity-related events, because this pleiotropic cytokine induces tumor growth in an autocrine manner, synthesis of acute phase response proteins in hepatocytes, growth of hemopoietic stem cells, and terminal differentiation of B cells into plasma cells and monocytes into macrophages (14) and directs the transition from innate to acquired immunity (15). Therefore, aberrant IL-6 expression has been associated with various chronic inflammatory disorders and autoimmune diseases, such as rheumatoid arthritis, Crohn??s disease, psoriasis, etc. (16, 17).


The proinflammatory gene transcriptional program of DCs challenged with LPS is activated through TLR4-induced signal transduction (18), that targets various downstream effectors such as NF-B. This transcription factor is a dimer composed of Rel protein family members. p52 and p50 precursor molecules (respectively, p100 and p105) and several Rel proteins with a transactivation domain such as p65, c-Rel, and RelB belong to this family. The prototype NF-B heterodimer, p50-p65, is kept inactive through binding to its inhibitor IB. The TLR4-signaling pathway operates via 2 adaptor-dependent mechanisms, which converge by recruitment of TNFR-associated factor 6 and TGF--activated protein kinase 1. The latter is responsible for MEK, MAPK kinase 4/7, and MAPK kinase 3/6 (and, respectively, ERK, JNK, and p38) activation and, moreover, indirectly activates the IB kinase (IKK) complex (reviewed in Ref. 19). Subsequently, this complex phosphorylates IB on serines 32 and 36 causing its ubiquitinylation and proteasomal degradation. This elimination liberates NF-B and permits its translocation into the nucleus, where it can bind to B promoter elements and induce related gene transcription of cytokines, chemokines, etc. (20).


In this study, we show that LPS-induced IL-6 production by human monocyte-derived DCs (MoDCs) is profoundly down-regulated by genistein. However, unlike previous data obtained on TNF--treated fibroblast cancer cells, MAPK signaling is only slightly affected, suggesting that genistein acts through different mechanisms in DCs. We have therefore analyzed the impact of this phytochemical on NF-B activation and localization. Furthermore, we have explored potential p53-NF-B cross-talk in response to genistein, which may be responsible for down-regulation of NF-B-dependent gene expression. On the whole, our results suggest that genistein acts as a potent modulator of DC functions and these findings highlight the anti-inflammatory and immunomodulatory properties of genistein, because DCs are critical players in the initiation and regulation of immune responses. In this view, genistein may represent an attractive dietary tool to dampen unwanted cellular immune response and excessive cytokine production after transplantation or in autoimmune diseases.


Materials and Methods


Mice


p53C/C and p53+/+ mice on a C57/BL6 background were described by Jacks et al. (21). Female and male mice were used for bone marrow extraction at the age of 4C7 wk. The mice were bred and maintained in specific pathogen-free conditions according to the institutional guidelines.


Generation of DCs


MoDCs were grown in RPMI 1640 supplemented with 10% FBS, 2 mM L-glutamine, 100 U/ml penicillin, 100 µg/ml streptomycin, 20 µg/ml geomycin, 1% nonessential amino acids, and 50 µM 2-ME. MoDCs were generated from PBMCs from healthy donors. Briefly, PBMCs in medium were allowed to adhere onto 75-cm2 flasks. After 2 h at 37??C, nonadherent cells were removed; and after extensive washing, adherent cells were cultured in complete medium containing recombinant human (h) GM-CSF (800 U/ml; Schering-Plough) and hIL-4 (200 U/ml; R&D Systems). Every 2 days, 800 U of hGM-CSF and 200 U of hIL-4 were added. On day 6 of culture, nonadherent cells, which correspond to the MoDC-enriched fraction, were harvested and used for experiments.


Bone marrow DCs (BMDCs) were cultured in RPMI 1640 Glutamax (Invitrogen) supplemented with 10% FCS, 100 U/ml penicillin, 100 µg/ml streptomycin, 55 µM 2-ME, and nonessential amino acids (Invitrogen). BMDCs were flushed with sterile PBS from the femurs and tibias of mice; 3.5 x 106 cells per 10-cm dish were plated out in complete medium supplemented with 10 ng/ml murine recombinant GM-CSF (Biosource and Peprotech). New medium with murine GM-CSF was added on day 3, and primary culture was replated on day 7 similarly to methods for day 0, followed by addition of fresh medium with murine GM-CSF on day 10. Cells were used in subsequent experiments on day 12. The BMDC population obtained with this protocol (originally described by Lutz et al. in Ref. 22) contained routinely >70% of CD11c+ DCs as assessed by FACS.


Stable cell lines, plasmid constructs, and reagents


The human embryonic kidney (HEK)293T cells stably expressing TLR4/MD2 have been described previously (23). The luciferase reporter constructs p1168hu.IL6P-luc+ and p(IL6-B)350hu.IL6P-luc+ have been used before (24, 25). The expression vector pCMV-HA-p53 and RNA interference (RNAi) construct pSUPER-p53 were described by Unger et al. (26) and Brummelkamp et al. (27), respectively. The pRcRSV-p65 expression vector was described earlier (28). LPS from Salmonella enterica (serotype abortus equi, used for HEK293T and BMDC) and from Escherichia coli (serotype 0128:B12, used for MoDC), DMSO, and genistein were from Sigma-Aldrich. Both LPS types were dissolved in sterile water and used at a final concentration of 1 µg/ml. FSL1 and polyinosinic-polycytidylic acid (poly(IC)) are from Invivogen and Amersham, respectively. Genistein was dissolved in DMSO to a stock concentration of 80 mM. DMSO was used as solvent control in an equal volume to the highest concentration of genistein treatment (0.25% v/v unless differently indicated in the figure legends). In none of the experiments did DMSO treatment show significant effects. Therefore, no-solvent conditions or DMSO controls were not shown in some experiments.


Transient transfection and luciferase assays


HEK293T cells were seeded in 24-well dishes and transiently transfected using the Lipofectamine transfection methods according to the manufacturer??s instructions (Invitrogen). After 18 h, cells were treated as indicated. Promoter activities were analyzed as described elsewhere (24).


EMSA


Nuclear and cytoplasmic extracts were prepared as described previously (25). Following quantification of protein amounts by the Bradford assay, 10 µg of nuclear extracts were analyzed for their binding activity to an IL-6-derived B sequence-containing probe essentially as described previously (29). The NF-B oligonucleotide 5'-AGCTATGTGGGATTTTCCCATGAGC-3' was labeled with Klenow enzyme using dCTP, and electrophoresis was conducted on a 6% native polyacrylamide gel. For supershift assays, anti-p65 C20 and anti-p50 NLS were included in the reaction mixture. The gels were dried and exposed to phosphorimager screens, which were scanned by StormScan Phosphorimager (Molecular Dynamics).


Western blotting


Total cellular extracts were made in Laemmli buffer (62.5 mM Tris-HCl (pH 6.8), 2% SDS, 10% glycerol, 50 mM DTT). Equal amounts of cytoplasmic/nuclear extracts or equal volumes of total lysates from each condition were resolved by 10% SDS-PAGE, transferred onto nitrocellulose membranes, and analyzed by Western blotting. Chemiluminescent detection was performed using HRP-coupled secondary Abs and Western lightning chemiluminescent reagent plus (PerkinElmer Life Sciences) on the Kodak image station 440CF. Anti-P-IKK, anti-P-ERK, anti-P-p38, anti-P-JNK, and anti-P-MSK1 were obtained from Cell Signaling. Anti-IB C21, anti-PARP H250, anti-Grb2 C23, anti-p53 DO1, anti-p65 C20, and anti-p50 C19 were purchased from Santa Cruz Biotechnology.


Flow cytometry


DCs were analyzed for the expression of cell surface molecules by flow cytometry. The following mouse anti-human IgG1 fluorochrome-coupled Abs were used: CD80-PE, CD86-PE, HLA-DR-FITC, and CD40-FITC (BD Biosciences).


Quantification of cytokine production


All cytokine levels in cell-free culture supernatants were determined using specific ELISA kits (Biosource) with detection limits of 15 pg/ml, according to the manufacturer??s instructions.


RNA isolation and RT-PCR


Total RNA was extracted with the acid guanidinium thiocyanate-phenol-chloroform method using the Trizol reagent (Invitrogen). Reverse transcription was performed on 0.5 µg of total RNA in a 30-µl total volume. After 1/5 dilution, quantitative real time PCR was performed on 5 µl of each condition using Bio-Rad iQ Supermix (for probe assay) or Invitrogen Sybr green platinum Supermix-UDG on a iCycler apparatus (Bio-Rad). The probe and primer sets were designed by primer3 software: hIL-6 forward (fw), GACAGCCACTCACCTCTTCA; hIL-6 reverse (rv), AGTGCCTCTTTGCTGCTTTC; hIL-6 probe, (6-FAM)CCTCGACGGCATCTCAGCCC(TAMRA) (phosphate); h--actin fw, GGATGCAGAAGGAGATCACTG; h--actin rv, CGATCCACACGGAGTACTTG; h--actin probe, (6-Fam)CCCTGGCACCCAGCACAATG(Tamra)(phosphate); mIL-6 fw, GAGGATACCACTCCCAACAGACC; mIL-6 rv, AAGTGCATCATCGTTGTTCATACA.


A serial dilution of a cDNA mix standard was used to determine the efficiency of the PCR. All amplifications were performed in duplicate or triplicate, and data were analyzed using Genex software (Bio-Rad) taking primer set efficiency into account.


Immunofluorescence assay


DCs were fixed with 2% paraformaldehyde-PBS, washed in PBS, and stored in methanol at C20??C. For the staining, DCs were attached to cytoslides by cytospin in PBS or to coverslips and permeabilized with 0.1% Triton X-100 followed by blocking with 2% BSA. For MoDC, coverslips were then incubated with rabbit polyclonal NF-B p65 Ab A (Santa Cruz Biotechnology) for 1 h at room temperature; after extensive washing, samples were incubated with the anti-rabbit Alexa 568 from Molecular Probes (Invitrogen). Then the slides were mounted in Vectashield mounting medium (Vector Laboratories). Specimens were analyzed with the Leica confocal SP2 laser scanning microscope. For BMDCs, cytoslides were incubated overnight with rabbit polyclonal p65 Ab C20 (Santa Cruz Biotechnology) at 4??C, washed, and incubated with anti-rabbit Alexa 488 (Molecular Probes and Invitrogen). Nuclei were stained using 4',6-diamidino-2-phenylindole, and coverslips were mounted on cytoslides with Vectashield (Vector Laboratories). Analysis was performed on the Zeiss Axiovert 200M immunofluorescence microscope.


Restriction enzyme accessibility assay (REA)


The REA technique was performed essentially as described earlier (30) with some modifications. In brief, nuclei were extracted using buffer A (10 mM Tris-HCl (pH 7.4), 10 mM NaCl, 3 mM MgCl2, 0.3 M sucrose) supplemented with 1 mM sodium butyrate and 0.5% Nonidet P-40. Purified nuclei (5 x 106) in buffer A with 1 mM sodium butyrate, 100 µg/ml BSA, and 0.1 mM PMSF were partially digested by 40 U of NheI (Promega) or BsrBI (New England Biolabs) restriction enzymes for 30 min at 37??C. Reactions were stopped by addition of 2x proteinase K buffer (100 mM Tris-HCl (pH 7.5), 1% SDS, 200 mM NaCl, 2 mM EDTA). After proteinase K and RNase A treatment, genomic DNA (gDNA) was twice phenol-chloroform and once chloroform extracted and dissolved in sterile water after ethanol precipitation. Purified gDNA (7C15 µg) was digested overnight with 30 U of PstI enzyme (Promega). Samples were analyzed by electrophoresis on a 1.5% agarose gel. After denaturation of the gel, capillary transfer to Hybond N+ membrane (Amersham) and UV-cross-linking, hybridization was performed with a 32P-labeled probe (HindIII-PstI) spanning nt +1756 to nt +2448 from the hIL-6 gene. The obtained bands NheI-PstI and BsrBI-PstI are 2674 and 2565/3021 bp, respectively. The restriction enzyme sites and band lengths are based on the human IL-6 mRNA sequence with accession number NM_000600, blasted to the human genome on www.ensembl.org.


Statistics


All statistical calculations were done in Graphprism version 3.0. according to one-way ANOVA (Bonferroni??s multiple comparison test) except for the data of Fig. 7B, which has been analyzed using an unpaired two-tailed Student t test. The degree of significance is indicated in the figures by: *, p < 0.5; **, p < 0.1; and ***, p < 0.01.


FIGURE 7. Genistein (Gen) acts via p53 on NF-B-mediated IL-6 transcription in murine BMDCs. A, p53+/+ and p53C/C BMDCs were pretreated with genistein (200 µM) or DMSO for 1 h, followed by LPS stimulation (1 µg/ml) for 40 min. Immunofluorescent staining using anti-p65 Ab was done as described in Materials and Methods on BMDC from three mice of each genotype. Representative pictures of each cell genotype and condition are shown. a, DMSO; b, LPS + DMSO; c, genistein; d, LPS + genistein for p65 detection, 4',6-diamidino-2-phenylindole (DAPI) staining, and overlay (Merge). B, p53+/+ and p53C/C BMDCs were pretreated with genistein (50 µM) or DMSO (0.125% v/v) for 1C2 h and stimulated with LPS (1 µg/ml) for 5C6 h. RNA was quantified, and equal amounts of all conditions were used in RT-PCR. IL-6 mRNA levels were determined by quantitative real time PCR. As a control, cDNA concentrations were measured with a Nanodrop ND-1000 spectrophotometer, and IL-6 mRNA levels were corrected to these values. Induction percentages of LPS + genistein relative to LPS + DMSO conditions for the BMDCs of each mouse are plotted in a scatter diagram, and the median is represented by a horizontal line. *, vs p53+/+ BMDC.


Results


Genistein strongly down-regulates TLR-dependent IL-6 production in MoDCs


In a first series of experiments, we examined whether or not genistein influences IL-6 cytokine production in MoDCs, in response to TLR2, TLR3, and TLR4 agonists. Investigation of IL-6 levels in the supernatant samples of two donors shows increased secreted IL-6 protein amounts after FSL1, poly(IC) and LPS stimulation, which are significantly reduced when pretreated with genistein (Table I). Because LPS elicits the highest IL-6 response, we further focused on this stimulus. A time kinetics experiment with LPS with/without genistein pretreatment reveals that LPS stimulation increases IL-6 levels and that genistein has a potent inhibitory effect on IL-6 cytokine production (Fig. 1A). An additional dose-response experiment, covering genistein concentrations from 200 µM to 6.25 µM confirms its repressive effect on LPS-stimulated IL-6 levels (Fig. 1B). A dose of 200 µM genistein, which was shown not to affect MoDC viability after 6 h of treatment, as assessed by phosphatidylinositol-annexin V-Alexa Fluor 488 staining (data not shown), was used in all subsequent experiments.


Table I. Genistein decreases IL-6 protein levels in stimulated MoDCsa


FIGURE 1. Genistein (Gen) decreases IL-6 production in LPS-stimulated MoDCs. DCs were left untreated, treated with genistein (200 µM or as indicated) or DMSO for 1C2 h, and then stimulated with LPS (1 µg/ml) as indicated (A) or during 24 h (B). IL-6 cytokine concentration was measured in the supernatants by ELISA. A, Time kinetics data are expressed as concentration IL-6 in picograms per milliliter. B, A 1/2 dilution series for genistein from 200 µM to 6.25 µM final concentration was made. ELISA results are expressed as percentage of IL-6 induction relative to the LPS condition. A sigmoidal dose-response curve is used for curve fitting. The calculated IC50 is 52.07 µM (R2 = 0.9731). The LPS + DMSO value (110%) is not included in the graph.


Genistein significantly reduces LPS-stimulated IL-6 transcription in MoDCs


To verify whether genistein affects IL-6 at the (post)translational level or acts at the transcriptional level, we performed quantitative real time RT-PCR on IL-6 mRNA. A time kinetics experiment with LPS was performed to examine the rate and extent of IL-6 mRNA production in MoDCs (Fig. 2A). This assay shows detectable IL-6 mRNA amounts already after 1 h, clearly abundant levels after 3 h, which rise up to 6 h or later. At 24 h, IL-6 signals are almost basal again. mRNA analysis after 6 h of LPS stimulation shows that IL-6 levels of MoDCs pretreated with genistein are strongly reduced (Fig. 2B), whereas the -actin mRNA levels remain unaffected.


FIGURE 2. Genistein (Gen) represses IL-6 transcription in LPS-stimulated MoDCs. A, DCs were stimulated with LPS (1 µg/ml) for different times. IL-6 mRNA levels were normalized to -actin mRNA values. B, DCs were left untreated, pretreated with genistein (200 µM) or DMSO for 1 h, and stimulated with LPS (1 µg/ml) during 6 h. IL-6 mRNA results were normalized to -actin mRNA levels, and the mean values of four different donors were calculated (??SD). The results are expressed relatively to the control setup (untreated). ***, vs LPS or LPS + DMSO. The LPS value is not significantly different from the LPS + DMSO value. C, DCs were pretreated with genistein (200 µM) or DMSO for 2 h and then stimulated with LPS (1 µg/ml) during 3 h. REA was performed as described in Materials and Methods. After treatment, DCs of four different donors were pooled per treatment condition. Of each, 15 µg of control and BsrBI-treated genomic DNA and 7 µg of NheI-treated samples were used for Southern blotting. Control samples of each condition were included in the experiment and treated totally similarly, except for the in vivo enzyme digestion. One representative experiment of three is shown. *, PstI-PstI band, 7710 bp; **, BsrBI-PstI band, 3021 bp; ***, NheI-PstI band, 2674 bp; ****, BsrBI-PstI band, 2565 bp; NS, nonspecific band. The IL-6 gDNA is visualized by a straight line, on which the position of the IL-6 proximal promoter and the NF-B site are indicated by an open rectangle and a filled circle, respectively. The probe, restriction enzyme cutting sites, and transcriptional start position are also shown.


To strengthen the indications that genistein negatively affects IL-6 mRNA production, we performed a restriction enzyme accessibility assay on the IL-6 gene promoter in MoDC as a read-out for chromatin relaxation and transcriptional activity (Ref. 31 and M. N. Ndlovu, C. Van Lint, D. Chalbos, G. Haegeman, and W. Vanden Berghe, submitted for publication). By the use of selected restriction enzymes that cut on specific positions in the IL-6 promoter, the local chromatin accessibility can be unveiled. Because the chromatin configuration and level of chromatin opening are tightly controlled and related to transcription initiation in general (32, 33, 34, 35), this test allows us to investigate possible effects of genistein on IL-6 transcription. As shown in Fig. 2C, after 3 h of LPS treatment, we can clearly observe a higher accessibility in the IL-6 proximal promoter region of MoDCs, as revealed by NheI or BsrBI digestion. In contrast, genistein pretreatment efficiently abrogates the LPS-stimulated chromatin opening. A more upstream promoter region containing an additional recognition site for the BsrBI enzyme was not remodeled upon LPS stimulation. The corresponding 3021-bp fragments can be considered as an internal control, showing equal loading of gDNA.


Proximal TLR4-initiated kinase signaling pathways in MoDCs are not significantly influenced by genistein


The clear reduction of IL-6 transcription roused us to explore whether genistein affects the related molecular signaling cascade toward the IL-6 gene promoter. MoDCs were either or not pretreated with genistein and stimulated with LPS in a 10- to 60-min kinetics (Fig. 3A). Western analysis of lysates shows LPS-induced IKK, MAPK (ERK, p38, JNK), and MSK1 activation in a time-dependent manner, with peak phosphorylations at 30 min. Consequently, the NF-B inhibitor IB is degraded at this time point and is even not resynthesized at 60 min. In contrast to the profound effects in fibroblast L929sA cells (4), genistein treatment only slightly lowers the phosphorylation peaks of MAPKs and MSK1, but does not affect the IKK phosphorylation pattern. However, statistical analysis of the band intensities of at least 2 Western blots (by Image J software) reveals that the observed differences at either time point do not reach significance (data not shown).


FIGURE 3. TLR4-dependent signaling cascades toward IL-6 gene transcription in MoDCs are not affected by genistein (Gen). A, DCs were either or not pretreated with genistein (200 µM) for 2 h, followed by stimulation with LPS (1 µg/ml) for the indicated times. Total cellular lysates were prepared, blotted, and analyzed with the respective (phospho-specific) Abs to visualize IB degradation and the amount of phosphorylated (P-) kinases in a time kinetics. The occurrence of aspecific bands and the control with anti-p65 for the different membranes (not shown) show equal protein loading in each lane. The presented pattern is a representative result of Western blotting experiments on a minimum of two donors. B, DCs were left untreated or treated with genistein (200 µM) or DMSO as indicated: 2 h, 1 h, 30 min before, simultaneously, or 30 min after adding LPS (1 µg/ml). The LPS stimulation lasted for 3 h. IL-6 mRNA levels were normalized to -actin mRNA values.


In line with the lack of effect on proximal receptor signaling, we still observe a significant reduction of IL-6 mRNA levels if genistein is added 30 min after LPS stimulation instead of 1C2 h in advance (Fig. 3B).


NF-B-dependent promoter activity in TLR4/MD2 HEK293T cells is significantly reduced by genistein


Because genistein potently inhibits TLR4-mediated IL-6 gene expression without profoundly affecting upstream signaling events such as MAPK and IKK activation, we continued by investigating further downstream events of these signal cascades. We performed reporter studies on a HEK293T cell line, which stably expresses TLR4/MD2 proteins (23). Of all known transcription factors binding to the IL-6 promoter region, we focused on NF-B because of its crucial role in triggering IL-6 transcription (36) and also because genistein and other isoflavones were previously reported to inhibit NF-B-mediated processes (5, 6, 37, 38, 39, 40). In accordance with the dose-dependent effect of genistein on endogenous IL-6 levels in MoDCs, genistein significantly lowers the LPS-stimulated NF-B-dependent promoter activity in these HEK293T cells (Fig. 4A). Moreover, in line with the results obtained with the synthetic NF-B reporter construct containing multimerized B sites, a similar dose-dependent genistein repression could be observed with another reporter construct, driven by the endogenous hIL-6 promoter sequence (results not shown). Furthermore, a severely impaired LPS response was measured in reporter experiments with a NF-B-mutated IL-6 promoter construct (data not shown).


FIGURE 4. NF-B-dependent promoter activity in TLR4/MD2 HEK293T cells is dose-dependently reduced by genistein (Gen). A, TLR4/MD2 HEK293T cells were transiently transfected with the p(IL6-B)350hu.IL6P+ reporter construct. Inductions were performed in triplicate. Cells were left untreated or treated with genistein (200, 100, 50 µM) or DMSO during 2 h and stimulated overnight with LPS (1 µg/ml). Equal amounts of protein lysates were analyzed in luciferase assays, and values are expressed as fold induction (??SD) relatively to the control (untreated). Two other independent experiments gave similar results. ***, vs LPS or LPS + DMSO. The LPS value is not significantly different from the LPS + DMSO value. B, DCs were either or not pretreated with genistein (200 µM) for 1 h and then stimulated with LPS (1 µg/ml) during 12 h. Expression of immunostimulatory molecules for DC function (CD40, HLA-DR, CD80, CD86) was analyzed by flow cytometry. DMSO vehicle control-treated cells did not show significant differences with LPS-treated cells. Results are plotted as percentage of expression relative to LPS values and are the mean (??SD) of three different donors, using mean values of histograms. ***, vs LPS + DMSO. Conc., Concentration.


Interestingly, because NF-B is generally involved in the LPS-triggered maturation process of DCs (41), we also studied some additional NF-B-driven cytokines and maturation markers in MoDCs (Fig. 4B). As such, we observe a significant repression of protein production of IL-12 p40, TNF- and IL-10. The induction of LPS + genistein relative to LPS + DMSO (arbitrarily set at 100%), after 6 h of stimulation using two donors, reaches 5.9% and nondetectable values for IL-12 p40; 13.4% and 6.5% for TNF-; and 14.9% and nondetectable values for IL-10. Even so, flow cytometric analysis shows reduced cell surface expression of Ag-presenting molecules and other maturation markers (CD40, HLA-DR, CD80, CD86).


Genistein attenuates LPS-induced NF-B-DNA binding in MoDCs


Mechanistic insight into the molecular effects of genistein on NF-B needs investigation of NF-B-related events after release from IB, the degradation of which is not influenced by genistein (see Fig. 3A). Thus, NF-B should be able to translocate to the nucleus. Therefore, we analyzed the capacity of NF-B to bind its recognition site in vitro after LPS with or without genistein pretreatment in DCs. For all conditions, nuclear extracts were subjected to gel shift (Fig. 5A). LPS treatment increases the DNA binding of NF-B, mainly p65-p50 heterodimers and p50 homodimers, as demonstrated by supershifting the corresponding bands with the respective Abs. Genistein pretreatment significantly diminishes both LPS-stimulated NF-B-DNA binding bands. In contrast, the binding of the constitutive complex recombination signal sequence-binding protein-J remains unaffected, which indicates specificity of the genistein effect and, at the same time, shows equal protein loading in the different setups (25).


FIGURE 5. Genistein (Gen) affects NF-B-DNA binding, localization, and p53 protein levels in MoDCs. DCs were left untreated, pretreated with genistein (200 µM) or DMSO during 2 h, and then stimulated with LPS (1 µg/ml) during 50 min for EMSA (A), during 40 min for Western analysis (B) or during 30 min for immunofluorescence assay (C). A, Nuclear extracts were prepared and analyzed in EMSA. Supershift was performed using 2 µg of anti-p50 and anti-p65 Abs in the reaction mixture. *, p65-p50 heterodimer; **, p50 homodimer; ***, RBP-J; NS, nonspecific band. One representative EMSA of three independent experiments on five different donors is shown. B, Equal amounts of nuclear and cytoplasmic extracts (10 µg) were analyzed by Western blotting. Detection of poly(ADP-ribose) polymerase (PARP) and growth factor receptor-bound protein 2 (Grb2) indicates equal loading and purity of the fractionated extracts. Values are one representative experiment of independently performed assays on four different donors. C, Immunofluorescent staining using anti-p65 (a) was performed as described in Materials and Methods. One representative field of each condition is shown. Phase contrast microscopy images give an overview on the whole cells (b). This experiment was repeated on four different donors, giving similar results.


Genistein influences NF-B subcellular localization in MoDCs


From Fig. 5A, it appears that genistein affects NF-B-DNA binding, although the upstream signaling to activate NF-B is intact (see Fig. 3A); thus, either the binding capacity of NF-B is changed or the nuclear abundance of NF-B is altered. We addressed this question by analyzing subcellular fractions of treated MoDCs for the abundance of the NF-B subunits identified in EMSA (see Fig. 5A). As shown in Fig. 5B, Western blotting results reveal a clear cytoplasmatic-nuclear shift of p65 and p50 after 40 min of LPS stimulation, in accordance with the full degradation of the cytoplasmic inhibitor IB at 30 min, shown in Western blotting of total lysates (see Fig. 3A). However, p65 and p50 subunits are less abundant in nuclear extracts, when DCs are pretreated with genistein as compared with the LPS-alone condition at the same time point. Confocal microscopy unambiguously reveals that genistein diminishes LPS-stimulated p65 nuclear localization in the majority of the cell population (Fig. 5C).


Genistein up-regulates p53 protein expression in MoDCs and p53 negatively affects NF-B-dependent gene expression in TLR4/MD2 HEK293T cells


Thus far, no molecular targets or activities of genistein have been elucidated in MoDCs, which could explain a decrease of nuclear NF-B, independently of IB. In literature, genistein is commonly known as a topoisomerase I (42) and II inhibitor (43, 44). In addition and concurrent with this activity, genistein is shown in cell lines to induce ataxia-telangioectasia-mutated kinase activity and to stabilize p53 proteins by increased phosphorylation on serine 15 (45, 46). On the basis of these reports, we proceeded by evaluating p53 protein levels of MoDCs in response to LPS with/without genistein in Western blotting (Fig. 5B). Basal p53 levels are rather low and mainly nuclear, given that p53 is a very unstable transcription factor in noncancerous cells. Interestingly, treatment with genistein alone or in combination with LPS is able to up-regulate p53 protein levels. Furthermore, p53 seems to have a repressive effect on the basal and LPS-stimulated IL-6 promoter activity as shown by transient transfection of increasing amounts of p53 expression vector (10C100 ng) in TLR4/MD2 HEK293T cells (Fig. 6A). Conversely, eliminating p53 by RNAi approaches totally reverses this reduction and even increases promoter activity levels above the levels of the corresponding setups without p53 RNAi, probably because HEK293T cells have high endogenous p53 levels, which are also affected by the RNAi system (data not shown). Finally, similar effects were observed on the NF-B-dependent synthetic (IL6-B)3 promoter (Fig. 6B) and endogenous IL-8 promoter reporter gene constructs (data not shown) upon overexpression of p53, further confirming that p53 affects NF-B-dependent transcription.


FIGURE 6. p53 affects NF-B-mediated promoter activity in TLR4/MD2 HEK293T cells. TLR4/MD2 HEK293T cells were transiently transfected with the full length p1168hu.IL6P-luc+ reporter, combined with 1 ng pRcRSV-p65 expression vector (A) or the p(IL6-B)350hu.IL6P-luc+ reporter (B). The pCMV-HA-p53 expression vector, with or without pSUPER-p53 added in similar amounts, was cotransfected in various concentrations (10, 50, 100 ng as indicated on the abscissas). Inductions were performed in triplicate, and luciferase values were measured in cell lysates after overnight LPS induction (1 µg/ml). Protein concentrations of lysates were determined and showed no significant differences. Values are plotted as arbitrary light units for each condition. For both reporter gene assays, one representative of two independently performed experiments is shown. ***, for p53 overexpression: vs the basal condition; for p53 RNAi: vs similar conditions in p53 overexpression without p53 RNAi.


Genistein acts via the repressor p53 on LPS-stimulated IL-6 transcription in BMDCs


To further investigate whether a similar p53-dependent NF-B regulation in DCs exists and to verify whether genistein acts via p53 on NF-B-dependent IL-6 expression in vivo, we used BMDCs from p53+/+ and p53C/C mice. As shown in Fig. 7A, immunofluorescence analysis of LPS-treated BMDCs shows a global cellular localization of p65 and an essentially predominant nuclear staining compared with the basal conditions. Of special note, genistein pretreatment clearly reduces the p65 nuclear abundance in the majority of p53+/+ BMDCs, but not in p53C/C cells. Next, we investigated whether these effects of genistein are also reflected at the level of endogenous IL-6 expression. Quantitative real time RT-PCR of p53+/+ BMDCs reveals a median reduction of 70% in LPS-stimulated IL-6 mRNA levels, when cells were pretreated with genistein. However, genistein has no significant repressive effect on LPS-stimulated IL-6 transcription in p53C/C BMDCs (Fig. 7B). In summary, these data clearly indicate that genistein-caused immunosuppression and attenuation of NF-B-mediated IL-6 gene transcription involve p53.


Discussion


In this study, we show that the isoflavone genistein profoundly represses LPS-stimulated IL-6 expression in MoDCs, as well as IL-6 production in response to other TLR stimuli (poly(IC) and FSL1). Genistein dose-dependently reduces secreted IL-6 protein levels (Table I and Fig. 1), presumably via its effects on IL-6 transcription (Fig. 2B). Although we cannot exclude additional posttranscriptional or (post)translational effects of genistein, the fact that complete repression of NF-B-driven IL-6 promoter constructs was observed after genistein pretreatment in reporter gene experiments in TLR4/MD2 HEK293T cells (Fig. 4A) strongly argues for IL-6 transcription as a primary genistein target. In addition, previous studies have correlated transcriptional activity with accessibility of the IL-6 core promoter region (32, 33, 34) (M. N. Ndlovu, C. Van Lint, D. Chalbos, G. Haegeman, and W. Vanden Berghe, submitted for publication). Therefore, the observation that genistein keeps the chromatin structure surrounding the proximal IL-6 promoter in a closed conformation (Fig. 2C) corroborates that genistein inhibits IL-6 gene expression at the transcriptional level.


At the conserved proximal promoter, various transcription factors such as AP-1, CREB, C/EBP-, specificity protein-1, and NF-B may regulate endogenous IL-6 chromatin transcription (Refs. 31, 47 , and 48 and references therein). However, given that we and others found that NF-B is a crucial mediator in IL-6 expression in response to (pro-)inflammatory stimuli (e.g., LPS, TNF, etc.) (36), we have further focused on the impact of genistein on the activation of this transcription factor. Essentially, we found that genistein interferes with NF-B subcellular localization and subsequently NF-B-DNA binding (Fig. 5). Effects of genistein on IL-6 promoter regulation were previously investigated in a murine fibrosarcoma cell line, showing blockage of the TNF--induced MEK1-ERK-MSK1 kinase cascade and, consequently, of p65 transactivation and IL-6 chromatin modifications (4). In contrast, we did not find significant effects of genistein on the classical signaling steps leading to NF-B activation in MoDCs (Fig. 3A). Instead, we observed that in MoDCs, genistein influences the expression level of the transcription factor p53 (Fig. 5B). Interestingly, p53 has the ability to decrease (TNF--induced) NF-B reporter gene activity (49, 50). Accordingly, we noticed that p53 acts as a repressor of basal and LPS-induced NF-B transactivation in TLR4/MD2 HEK293T reporter gene assays (Fig. 6). Moreover, on the basis of our results with p53+/+ and p53C/C BMDCs, we suggest that genistein effects depend on p53 activity, which counteracts NF-B-mediated IL-6 transcription (Fig. 7B). These observations argue for cell type-specific (fibroblast vs MoDC) and/or stimulus-specific (TNF- vs LPS) molecular effects of genistein. It would be interesting to ascertain whether other cells of the innate or adaptive immune system show a similar p53-dependent inhibition of LPS-stimulated NF-B-driven gene expression in response to genistein.


The genistein-mediated increase in p53 protein levels is presumably due to protein stabilization, as we have noticed serine 15 phosphorylation of p53 only after genistein treatment (data not shown and Ref. 51). This residue among others confers p53 stability by regulating association with mouse double minute 2, an oncogenic inhibitor that possesses ubiquitin ligase activities on itself and its target p53 (51). However, other related mechanisms of genistein such as mouse double minute 2 down-regulation by ubiquitinylation cannot be excluded (52).


Apart from in vitro studies on p53-NF-B cross-talk, p53 also appears to act as a repressor of NF-B in vivo, because NF-B-dependent cytokines are elevated in LPS-treated p53C/C macrophages (53) and thymus/spleen tissue (50). Furthermore, p53 mutations have been found to elicit hyperinflammatory conditions, which increase the severity of chronic diseases (54) and promote cancer progression (55). However, how exactly p53 affects NF-B remains an open question. Some research groups suggest that their reciprocal inhibition is due to the common use of a limiting pool of coactivators (49, 56, 57). Others reported a p53-mediated increase in IB expression, which sequesters NF-B in the cytoplasm (58). A direct association between p53 and p65, which mutually compromises their activation potential, has been reported too (59, 60). Thus far, we have not been able to detect remaining endogenous IB levels upon LPS + genistein cotreatment of MoDC, which could have explained the reduced nuclear abundance of NF-B (Fig. 3A). Actually, it seems more plausible that p53 affects NF-B nucleocytoplasmic shuttling by blocking nuclear import of NF-B or by stimulating its nuclear export (61, 62). Alternatively, genistein may promote nuclear degradation of NF-B. Elucidation of the precise mechanism of mutual cross-talk between p53 and NF-B needs further investigation.


p53-dependent suppression of IL-6 promoter activity has been attributed to interference with C/EBP, CREB, and AP-1 activities as well (55, 63, 64). Thus, inhibition of IL-6 transcription by p53 may be a cumulative effect of multiple regulatory effects on transcription factors, cofactors (CREB-binding protein/p300), or chromatin remodeling factors (Brg1, SWI/SNF), given that the reduction in NF-B-DNA binding in response to genistein (Fig. 5A) is less pronounced than the effects on IL-6 transcription (Figs. 2B and 4) and promoter accessibility (Fig. 2C) in MoDCs.


Although our analysis of genistein-mediated effects on NF-B has essentially focused on p65 and p50, we cannot exclude p53 effects on other NF-B family members such as p52, c-Rel or RelB, which are also considered important in regulating cytokine expression in immune cells (65, 66). However, we have not been able to detect significant binding of these NF-B proteins as revealed by supershift analysis of nuclear extracts from LPS-induced MoDCs (67).


In conclusion, we found that the soy isoflavone genistein significantly reduces expression of various NF-B-mediated genes (cytokines, Ag-presenting HLA-DR, (co-)stimulatory molecules; see results text and Fig. 4B) and suppresses global DC maturation in a p53-dependent manner. In that sense, these findings open up new perspectives for dietary (by phytochemicals) or therapeutic (by p53 activators such as nutlins; see Ref. 68) interventions in transplantation or immune disorders such as allergy, asthma, or autoimmunity, because it could dampen unwanted or excessive immune responses. In contrast, these indications warrant further investigation of possible health-disturbing effects of genistein-containing products, such as soy milk, on infants, whose immune system development is still in a premature state.


Acknowledgments


We thank M. Nguyen for generating DCs out of blood buffy coats; K. Van Wesemael, J. Claes, and P. Faes for technical support; S. De Koker for assistance in flow cytometry of BMDCs; and other members of both laboratories for their practical help, suggestions, and critical comments.


Disclosures


The authors have no financial conflict of interest.


【参考文献】
  King, A., G. Young. 1999. Characteristics and occurrence of phenolic phytochemicals. J. Am. Diet. Assoc. 99: 213-218.

Liu, J., J. E. Burdette, H. Xu, C. Gu, R. B. van Breemen, K. P. Bhat, N. Booth, A. I. Constantinou, J. M. Pezzuto, H. H. Fong, et al 2001. Evaluation of estrogenic activity of plant extracts for the potential treatment of menopausal symptoms. J. Agric. Food Chem. 49: 2472-2479.

Dijsselbloem, N., W. Vanden Berghe, A. De Naeyer, G. Haegeman. 2004. Soy isoflavone phyto-pharmaceuticals in interleukin-6 affections: multi-purpose nutraceuticals at the crossroad of hormone replacement, anti-cancer and anti-inflammatory therapy. Biochem. Pharmacol. 68: 1171-1185.

Vanden Berghe, W., N. Dijsselbloem, L. Vermeulen, N. Ndlovu, E. Boone, G. Haegeman. 2006. Attenuation of mitogen- and stress-activated protein kinase-1-driven nuclear factor-B gene expression by soy isoflavones does not require estrogenic activity. Cancer Res. 66: 4852-4862.

Kang, J. S., Y. D. Yoon, M. H. Han, S. B. Han, K. Lee, M. R. Kang, E. Y. Moon, Y. J. Jeon, S. K. Park, H. M. Kim. 2005. Estrogen receptor-independent inhibition of tumor necrosis factor- gene expression by phytoestrogen equol is mediated by blocking nuclear factor-B activation in mouse macrophages. Biochem. Pharmacol. 71: 136-143.

Gong, L., Y. Li, A. Nedeljkovic-Kurepa, F. H. Sarkar. 2003. Inactivation of NF-B by genistein is mediated via Akt signaling pathway in breast cancer cells. Oncogene 22: 4702-4709.

Cooke, P. S., V. Selvaraj, S. Yellayi. 2006. Genistein, estrogen receptors, and the acquired immune response. J. Nutr. 136: 704-708.

Mazzoni, A., D. M. Segal. 2004. Controlling the Toll road to dendritic cell polarization. J. Leukocyte Biol. 75: 721-730.

Trinchieri, G.. 1995. Interleukin-12: a proinflammatory cytokine with immunoregulatory functions that bridge innate resistance and antigen-specific adaptive immunity. Annu. Rev. Immunol. 13: 251-276.

Swain, S. L., A. D. Weinberg, M. English, G. Huston. 1990. IL-4 directs the development of Th2-like helper effectors. J. Immunol. 145: 3796-3806.

Diehl, S., M. Rincon. 2002. The two faces of IL-6 on Th1/Th2 differentiation. Mol. Immunol. 39: 531-536.

Rincon, M., J. Anguita, T. Nakamura, E. Fikrig, R. A. Flavell. 1997. Interleukin (IL)-6 directs the differentiation of IL-4-producing CD4+ T cells. J. Exp. Med. 185: 461-469.

Bettelli, E., Y. Carrier, W. Gao, T. Korn, T. B. Strom, M. Oukka, H. L. Weiner, V. K. Kuchroo. 2006. Reciprocal developmental pathways for the generation of pathogenic effector TH17 and regulatory T cells. Nature 441: 235-238.

Hirano, T.. 1998. Interleukin 6 and its receptor: ten years later. Int. Rev. Immunol. 16: 249-284.

Jones, S. A.. 2005. Directing transition from innate to acquired immunity: defining a role for IL-6. J. Immunol. 175: 3463-3468.

Nishimoto, N.. 2005. Cytokine signal regulation and autoimmune disorders. Autoimmunity 38: 359-367.

Ishihara, K., T. Hirano. 2002. IL-6 in autoimmune disease and chronic inflammatory proliferative disease. Cytokine Growth Factor Rev. 13: 357-368.

Akira, S., K. Takeda, T. Kaisho. 2001. Toll-like receptors: critical proteins linking innate and acquired immunity. Nat. Immunol. 2: 675-680.

Kawai, T., S. Akira. 2006. TLR signaling. Cell Death Differ. 13: 816-825.

Karin, M., Y. Ben-Neriah. 2000. Phosphorylation meets ubiquitination: the control of NF-B activity. Annu. Rev. Immunol. 18: 621-663.

Jacks, T., L. Remington, B. O. Williams, E. M. Schmitt, S. Halachmi, R. T. Bronson, R. A. Weinberg. 1994. Tumor spectrum analysis in p53-mutant mice. Curr. Biol. 4: 1-7.

Lutz, M. B., N. Kukutsch, A. L. Ogilvie, S. Rossner, F. Koch, N. Romani, G. Schuler. 1999. An advanced culture method for generating large quantities of highly pure dendritic cells from mouse bone marrow. J. Immunol. Methods 223: 77-92.

Latz, E., A. Visintin, E. Lien, K. A. Fitzgerald, B. G. Monks, E. A. Kurt-Jones, D. T. Golenbock, T. Espevik. 2002. Lipopolysaccharide rapidly traffics to and from the Golgi apparatus with the Toll-like receptor 4-MD-2-CD14 complex in a process that is distinct from the initiation of signal transduction. J. Biol. Chem. 277: 47834-47843.

Vanden Berghe, W., S. Plaisance, E. Boone, K. De Bosscher, M. L. Schmitz, W. Fiers, G. Haegeman. 1998. p38 and extracellular signal-regulated kinase mitogen-activated protein kinase pathways are required for nuclear factor-B p65 transactivation mediated by tumor necrosis factor. J. Biol. Chem. 273: 3285-3290.

Plaisance, S., W. Vanden Berghe, E. Boone, W. Fiers, G. Haegeman. 1997. Recombination signal sequence binding protein J is constitutively bound to the NF-B site of the interleukin-6 promoter and acts as a negative regulatory factor. Mol. Cell. Biol. 17: 3733-3743.

Unger, T., M. M. Nau, S. Segal, J. D. Minna. 1992. p53: a transdominant regulator of transcription whose function is ablated by mutations occurring in human cancer. EMBO J. 11: 1383-1390.

Brummelkamp, T. R., R. Bernards, R. Agami. 2002. A system for stable expression of short interfering RNAs in mammalian cells. Science 296: 550-553.

Vermeulen, L., G. De Wilde, P. Van Damme, W. Vanden Berghe, G. Haegeman. 2003. Transcriptional activation of the NF-B p65 subunit by mitogen- and stress-activated protein kinase-1 (MSK1). EMBO J. 22: 1313-1324.

De Bosscher, K., M. L. Schmitz, W. Vanden Berghe, S. Plaisance, W. Fiers, G. Haegeman. 1997. Glucocorticoid-mediated repression of nuclear factor-B-dependent transcription involves direct interference with transactivation. Proc. Natl. Acad. Sci. USA 94: 13504-13509.

Verdin, E., P. Paras, Jr, C. Van Lint. 1993. Chromatin disruption in the promoter of human immunodeficiency virus type 1 during transcriptional activation. EMBO J. 12: 3249-3259.

Armenante, F., M. Merola, A. Furia, M. Tovey, M. Palmieri. 1999. Interleukin-6 repression is associated with a distinctive chromatin structure of the gene. Nucleic Acids Res. 27: 4483-4490.

Lomvardas, S., D. Thanos. 2002. Modifying gene expression programs by altering core promoter chromatin architecture. Cell 110: 261-271.

Smale, S. T., A. G. Fisher. 2002. Chromatin structure and gene regulation in the immune system. Annu. Rev. Immunol. 20: 427-462.

Ramirez-Carrozzi, V. R., A. A. Nazarian, C. C. Li, S. L. Gore, R. Sridharan, A. N. Imbalzano, S. T. Smale. 2006. Selective and antagonistic functions of SWI/SNF and Mi-2 nucleosome remodeling complexes during an inflammatory response. Genes Dev. 20: 282-296.

Vanden Berghe, W., M. N. Ndlovu, R. Hoya-Arias, N. Dijsselbloem, S. Gerlo, G. Haegeman. 2006. Keeping up NF-B appearances: epigenetic control of immunity or inflammation-triggered epigenetics. Biochem. Pharmacol. 72: 1114-1131.

Vanden Berghe, W., K. De Bosscher, E. Boone, S. Plaisance, G. Haegeman. 1999. The nuclear factor-B engages CBP/p300 and histone acetyltransferase activity for transcriptional activation of the interleukin-6 gene promoter. J. Biol. Chem. 274: 32091-32098.

Li, Y., F. Ahmed, S. Ali, P. A. Philip, O. Kucuk, F. H. Sarkar. 2005. Inactivation of nuclear factor B by soy isoflavone genistein contributes to increased apoptosis induced by chemotherapeutic agents in human cancer cells. Cancer Res. 65: 6934-6942.

Raffoul, J. J., Y. Wang, O. Kucuk, J. D. Forman, F. H. Sarkar, G. G. Hillman. 2006. Genistein inhibits radiation-induced activation of NF-B in prostate cancer cells promoting apoptosis and G2/M cell cycle arrest. BMC Cancer 6: 107

Wang, Z., Y. Zhang, S. Banerjee, Y. Li, F. H. Sarkar. 2006. Inhibition of nuclear factor B activity by genistein is mediated via Notch-1 signaling pathway in pancreatic cancer cells. Int. J. Cancer 118: 1930-1936.

Comalada, M., I. Ballester, E. Bailon, S. Sierra, J. Xaus, J. Galvez, F. S. Medina, A. Zarzuelo. 2006. Inhibition of proinflammatory markers in primary bone marrow-derived mouse macrophages by naturally occurring flavonoids: analysis of the structure-activity relationship. Biochem. Pharmacol. 72: 1010-1021.

Yoshimura, S., J. Bondeson, B. M. Foxwell, F. M. Brennan, M. Feldmann. 2001. Effective antigen presentation by dendritic cells is NF-B dependent: coordinate regulation of MHC, co-stimulatory molecules and cytokines. Int. Immunol. 13: 675-683.

Okura, A., H. Arakawa, H. Oka, T. Yoshinari, Y. Monden. 1988. Effect of genistein on topoisomerase activity and on the growth of

Markovits, J., C. Linassier, P. Fosse, J. Couprie, J. Pierre, A. Jacquemin-Sablon, J. M. Saucier, J. B. Le Pecq, A. K. Larsen. 1989. Inhibitory effects of the tyrosine kinase inhibitor genistein on mammalian DNA topoisomerase II. Cancer Res. 49: 5111-5117.

Constantinou, A., R. Mehta, C. Runyan, K. Rao, A. Vaughan, R. Moon. 1995. Flavonoids as DNA topoisomerase antagonists and poisons: structure-activity relationships. J. Nat. Prod. 58: 217-225.

Ye, R., A. A. Goodarzi, E. U. Kurz, S. Saito, Y. Higashimoto, M. F. Lavin, E. Appella, C. W. Anderson, S. P. Lees-Miller. 2004. The isoflavonoids genistein and quercetin activate different stress signaling pathways as shown by analysis of site-specific phosphorylation of ATM, p53 and histone H2AX. DNA Repair (Amst.). 3: 235-244.

Chang, K. L., M. L. Kung, N. H. Chow, S. J. Su. 2004. Genistein arrests hepatoma cells at G2/M phase: involvement of ATM activation and upregulation of p21waf1/cip1 and Wee1. Biochem. Pharmacol. 67: 717-726.

Sanceau, J., T. Kaisho, T. Hirano, J. Wietzerbin. 1995. Triggering of the human interleukin-6 gene by interferon- and tumor necrosis factor- in monocytic cells involves cooperation between interferon regulatory factor-1, NF B, and Sp1 transcription factors. J. Biol. Chem. 270: 27920-27931.

Kang, S. H., D. A. Brown, I. Kitajima, X. Xu, O. Heidenreich, S. Gryaznov, M. Nerenberg. 1996. Binding and functional effects of transcriptional factor Sp1 on the murine interleukin-6 promotor. J. Biol. Chem. 271: 7330-7335.

Webster, G. A., N. D. Perkins. 1999. Transcriptional cross talk between NF-B and p53. Mol. Cell. Biol. 19: 3485-3495.

Komarova, E. A., V. Krivokrysenko, K. Wang, N. Neznanov, M. V. Chernov, P. G. Komarov, M. L. Brennan, T. V. Golovkina, O. W. Rokhlin, D. V. Kuprash, et al 2005. p53 is a suppressor of inflammatory response in mice. FASEB J. 19: 1030-1032.

Alarcon-Vargas, D., Z. Ronai. 2002. p53-Mdm2: the affair that never ends. Carcinogenesis 23: 541-547.

Li, M., Z. Zhang, D. L. Hill, X. Chen, H. Wang, R. Zhang. 2005. Genistein, a dietary isoflavone, down-regulates the MDM2 oncogene at both transcriptional and posttranslational levels. Cancer Res. 65: 8200-8208.

Zheng, S. J., S. E. Lamhamedi-Cherradi, P. Wang, L. Xu, Y. H. Chen. 2005. Tumor suppressor p53 inhibits autoimmune inflammation and macrophage function. Diabetes 54: 1423-1428.

Yamanishi, Y., D. L. Boyle, M. J. Pinkoski, A. Mahboubi, T. Lin, Z. Han, N. J. Zvaifler, D. R. Green, G. S. Firestein. 2002. Regulation of joint destruction and inflammation by p53 in collagen-induced arthritis. Am. J. Pathol. 160: 123-130.

Angelo, L. S., M. Talpaz, R. Kurzrock. 2002. Autocrine interleukin-6 production in renal cell carcinoma: evidence for the involvement of p53. Cancer Res. 62: 932-940.

Wadgaonkar, R., K. M. Phelps, Z. Haque, A. J. Williams, E. S. Silverman, T. Collins. 1999. CREB-binding protein is a nuclear integrator of nuclear factor-B and p53 signaling. J. Biol. Chem. 274: 1879-1882.

Ravi, R., B. Mookerjee, Y. van Hensbergen, G. C. Bedi, A. Giordano, W. S. El-Deiry, E. J. Fuchs, A. Bedi. 1998. p53-mediated repression of nuclear factor-B RelA via the transcriptional integrator p300. Cancer Res. 58: 4531-4536.

Shao, J., T. Fujiwara, Y. Kadowaki, T. Fukazawa, T. Waku, T. Itoshima, T. Yamatsuji, M. Nishizaki, J. A. Roth, N. Tanaka. 2000. Overexpression of the wild-type p53 gene inhibits NF-B activity and synergizes with aspirin to induce apoptosis in human colon cancer cells. Oncogene 19: 726-736.

Jeong, S. J., M. Radonovich, J. N. Brady, C. A. Pise-Masison. 2004. HTLV-I Tax induces a novel interaction between p65/RelA and p53 that results in inhibition of p53 transcriptional activity. Blood 104: 1490-1497.

Ikeda, A., X. Sun, Y. Li, Y. Zhang, R. Eckner, T. S. Doi, T. Takahashi, Y. Obata, K. Yoshioka, K. Yamamoto. 2000. p300/CBP-dependent and -independent transcriptional interference between NF-B RelA and p53. Biochem. Biophys. Res. Commun. 272: 375-379.

Feng, Z., L. Kachnic, J. Zhang, S. N. Powell, F. Xia. 2004. DNA damage induces p53-dependent BRCA1 nuclear export. J. Biol. Chem. 279: 28574-28584.

Feldherr, C. M., D. Akin, R. J. Cohen. 2001. Regulation of functional nuclear pore size in fibroblasts. J. Cell Sci. 114: 4621-4627.

Margulies, L., P. B. Sehgal. 1993. Modulation of the human interleukin-6 promoter (IL-6) and transcription factor C/EBP (NF-IL6) activity by p53 species. J. Biol. Chem. 268: 15096-15100.

Asschert, J. G., E. G. De Vries, S. De Jong, S. Withoff, E. Vellenga. 1999. Differential regulation of IL-6 promoter activity in a human ovarian-tumor cell line transfected with various p53 mutants: involvement of AP-1. Int. J. Cancer 81: 236-242.

Sanjabi, S., A. Hoffmann, H. C. Liou, D. Baltimore, S. T. Smale. 2000. Selective requirement for c-Rel during IL-12 p40 gene induction in macrophages. Proc. Natl. Acad. Sci. USA 97: 12705-12710.

Grumont, R., H. Hochrein, M. O??Keeffe, R. Gugasyan, C. White, I. Caminschi, W. Cook, S. Gerondakis. 2001. c-Rel regulates interleukin 12 p70 expression in CD8+ dendritic cells by specifically inducing p35 gene transcription. J. Exp. Med. 194: 1021-1032.

Goriely, S., C. Van Lint, R. Dadkhah, M. Libin, D. De Wit, D. Demonte, F. Willems, M. Goldman. 2004. A defect in nucleosome remodeling prevents IL-12(p35) gene transcription in neonatal dendritic cells. J. Exp. Med. 199: 1011-1016.

Vassilev, L. T.. 2004. Small-molecule antagonists of p53-MDM2 binding: research tools and potential therapeutics. Cell Cycle 3: 419-421.

  订阅登记:

请您在下面输入常用的Email地址、职业以便我们定期通过邮箱发送给您最新的相关医学信息,感谢您浏览首席医学网!

邮箱:    职业: