A Switch From Prohormone Convertase (PC)-2 to PC1/3 Expression in Transplanted -Cells Is Accompanied by Differential Processing of Proglucagon and Improved Glucose Homeostasis in Mice
-
首席医学网
2008年06月03日 23:06:43 Tuesday
-
作者：Rhonda D. Wideman, Scott D. Covey, Gene C. Webb, Daniel J. Drucker, and Timothy J. Kieffer, 作者单位：Department of Cellular and Physiological Sciences, Laboratory of Molecular and Cellular Medicine, Life Sciences Institute, University of British Columbia, Vancouver, British Columbia, Canada ;Department of Medicine, University of Chicago, Chicago, Illinois ;Department of Medicine, Samuel Lunenfeld R
加入收藏夹
【摘要】 OBJECTIVE—Glucagon, which raises blood glucose levels by stimulating hepatic glucose production, is produced in -cells via cleavage of proglucagon by prohormone convertase (PC)-2. In the enteroendocrine L-cell, proglucagon is differentially processed by the alternate enzyme PC1/3 to yield glucagon-like peptide (GLP)-1, GLP-2, and oxyntomodulin, which have blood glucose–lowering effects. We hypothesized that alteration of PC expression in -cells might convert the -cell from a hyperglycemia-promoting cell to one that would improve glucose homeostasis.
【关键词】 AUC, area under the curve; GLP, glucagon-like peptide; IPGTT, intraperitoneal glucose tolerance test; PC, prohormone convertase; PCNA, proliferating cell nuclear antigen; PGDP, proglucagon-derived peptide; STZ, streptozotocin
RESEARCH DESIGN AND METHODS—We compared the effect of transplanting encapsulated PC2-expressing TC-1 cells with PC1/3-expressing TCPC2 cells in normal mice and low-dose streptozotocin (STZ)-treated mice.
RESULTS—Transplantation of PC2-expressing -cells increased plasma glucagon levels and caused mild fasting hyperglycemia, impaired glucose tolerance, and -cell hypoplasia. In contrast, PC1/3-expressing -cells increased plasma GLP-1/GLP-2 levels, improved glucose tolerance, and promoted -cell proliferation. In GLP-1R–/– mice, the ability of PC1/3-expressing -cells to improve glucose tolerance was attenuated. Transplantation of PC1/3-expressing -cells prevented STZ-induced hyperglycemia by preserving -cell area and islet morphology, possibly via stimulating -cell replication. However, PC2-expressing -cells neither prevented STZ-induced hyperglycemia nor increased -cell proliferation. Transplantation of TCPC2, but not TC-1 cells, also increased intestinal epithelial proliferation.
CONCLUSIONS—Expression of PC1/3 rather than PC2 in -cells induces GLP-1 and GLP-2 production and converts the -cell from a hyperglycemia-promoting cell to one that lowers blood glucose levels and promotes islet survival. This suggests that alteration of proglucagon processing in the -cell may be therapeutically useful in the context of diabetes.
The proglucagon precursor gives rise to numerous peptides belonging to the glucagon superfamily of hormones (1). Despite significant peptide sequence homology, members of this superfamily exert diverse and sometimes opposing regulatory functions. Proglucagon is expressed in pancreatic -cells, intestinal L-cells, and specific neurons in the central nervous system. Tissue-specific posttranslational processing by prohormone convertase (PC)-1/3 or PC2 results in a different profile of proglucagon-derived peptides (PGDPs) in these tissues. Thus, as a result of cleavage by PC2, the major bioactive PGDP arising in pancreatic -cells is glucagon (2,3), which serves as a counterregulatory hormone opposing insulin action by increasing hepatic glucose output. While the activity of glucagon is critical for preventing hypoglycemia under normal conditions, hyperglucagonemia accompanies diabetes and may contribute to its pathology (4). Indeed, suppression of glucagon action using immunoneutralization, antisense oligonucleotides, or glucagon receptor antagonists improves glucose handling in both rodents (5,6) and humans (7,8).
In contrast to the -cell, in the enteroendocrine L-cell and the brain, glucagon-like peptide (GLP)-1, GLP-2, and oxyntomodulin are released from proglucagon via the alternate processing enzyme PC1/3 (9,10). GLP-1 elicits effects that tend to lower blood glucose, including stimulation of insulin synthesis and secretion, inhibition of gastric emptying and food intake, and promotion of -cell survival and proliferation (1,11). This complement of antidiabetic effects has led to much interest in developing long-acting GLP-1 mimetics as a treatment for diabetes. GLP-2 and oxyntomodulin also tend to lower blood glucose levels by promoting satiety and inhibiting gastric emptying (12,13). Thus, depending on whether it is processed by PC2 or PC1/3, proglucagon gives rise to products having either glucose-raising or glucose-lowering effects.
We hypothesized that expression of PC1/3 rather than PC2 in -cells might shift the PGDP profile to become more like that of the L-cell and thereby convert the -cell from a hyperglycemia-promoting cell to one that would lower blood glucose levels. We therefore sought to directly compare the in vivo effects of PC2- versus PC1/3-derived PGDPs on glucose homeostasis, -cell survival, and morphology of the pancreas and jejunum in normal mice and in a mouse model of type 1 diabetes.
RESEARCH DESIGN AND METHODS
Tissue culture media, antibiotics, and fetal bovine serum were obtained from Invitrogen Canada (Burlington, Ontario, Canada). Active GLP-1 enzyme-linked immunosorbent assay, total GLP-1 radioimmunoassay, and glucagon radioimmunoassay kits were from Linco Research (St. Charles, MO). Glucagon and GLP-2 enzyme immunoassay kits were from Alpco Diagnostics (Salem, NH). Western blotting reagents were from GE Healthcare (Buckinghamshire, U.K.). TC-1 (clone 9) cells were from the American Type Culture Collection. Imaging and quantification was performed using an Axiovert 200 microscope (Carl Zeiss, Toronto, Ontario, Canada) connected to a digital camera (Retiga 2000R; QImaging, Burnaby, British Columbia, Canada) controlled with Openlab 5.0 software (Improvision, Lexington, MA).
Cell culture and analysis.
TCPC2 cells are an -cell line derived from mice lacking active PC2, precluding glucagon production, and have been described previously (14). TC-1 and TCPC2 cells were cultured in high-glucose Dulbecco’s modified Eagle medium containing 10% fetal bovine serum, 100 units/ml penicillin, and 100 μg/ml streptomycin. Cells were maintained at 37°C/5% CO2, with media refreshment every 2–4 days. Experiments were performed using passages 10–14 or 20–29 for TC-1 and TCPC2 cells, respectively. Cells were seeded at equal density in six-well plates, and media were collected after a 24-h static incubation and assayed for glucagon or active GLP-1 content. Equal amounts of protein from cell lysates were electrophoresed on a 10% polyacrylamide gel and transferred to a 0.2-μm polyvinylidene difluoride membrane (Bio-Rad, Hercules, CA). After blocking (5% milk powder in TBS + 0.1% Tween-20), the membrane was incubated with anti-PC1/3 antiserum (1:1,000) and developed using horseradish peroxidase–conjugated secondary antibody (1:5,000) and chemiluminescence reagents.
Animal experiments.
Male mice, age 8–10 weeks, were used for all experiments. CD-1 mice were from the University of British Columbia Animal Care Facility, and C57BL/6 mice were from Jackson Laboratories (Bar Harbor, ME). All experiments were approved by the University of British Columbia Animal Care Committee. Mice were maintained on a standard 12-h light/dark cycle and received a standard diet. Blood glucose and body weight were monitored two to three times weekly after a 4-h morning fast. Blood glucose monitoring and survival blood sampling was carried out on restrained unanaesthetized mice via the saphenous vein.
GLP-1R–/– mice (15) and wild-type littermates were maintained on a C57BL/6 background and genotyped using PCR primers that amplify 437 bp of the GLP-1R in transmembrane domains 2–4, the region disrupted in mice bearing a knockout allele (16) (forward 5'TACACAATGGGGAGCCCCTA3'; reverse 5'AAGTCATGGGATGTGTCTGGA3') and primers that amplify 280 bp of the NeoR insert (forward 5'CTTGGGTGGAGAGGCTATTC3'; reverse 5'AGGTGAGATGACAGGAGATC3'). PCR was carried out as follows using standard reaction mix with 1.5 mmol/l MgCl2: 2 min at 94°C; 30 cycles of 94°C for 1 min, 61°C for 1 min, and 72°C for 1 min; and 72°C for 10 min. Wild-type mice had a single 437-bp product, GLP-1R–/– mice had a single 280-bp product, and GLP-1R+/– mice had both products.
Encapsulation and transplantation of cells.
Cells were grown to 80% confluence. After trypsinization, cells were washed in PBS without CaCl2, and a cell count was performed using a hematocytometer. Cells were resuspended in a mixture of 1.5% sodium alginate (IE-1010; Inotech Biosystems International, Rockville, MD) and morpholinepropanesulfonic acid, transferred to a sterile encapsulator (Inotech Biosystems International), and encapsulated according to the manufacturer’s instructions. Capsules (700 μm) were washed in PBS without CaCl2 and loaded to sterile syringes attached to 18-G catheters. Recipient mice were anesthetized using isoflurane, and an incision was made midway between the ventral midline and the animal’s side, 1.5 cm anterior of the hind leg. Capsules were injected to the intraperitoneal cavity, and the musculature and skin were closed with a running suture and a wound clip, respectively. For all experiments, 1.4–2.2 ml of capsules (4.0 x 107 cells/mouse) were transplanted in <3 ml total volume. Transplants were completed within 1.5 h of cell encapsulation. Sham-operated mice received an equal volume of sterile saline under identical conditions.
In vivo glucose tolerance testing.
Glucose tolerance tests were performed by oral gavage (oral glucose tolerance test) or intraperitoneal (intraperitoneal glucose tolerance test [IPGTT]) delivery of glucose (2 g/kg) to recipient mice after an overnight fast. Blood glucose was monitored for 2 h after glucose delivery. Where blood glucose levels exceeded the limit of detection for the blood glucose meter, samples were diluted 1:2 in saline.
Streptozotocin treatment of C57BL/6 mice.
Streptozotocin (STZ) (Sigma, St. Louis, MO) was prepared in citrate buffer (pH 4.5) and delivered by intraperitoneal injection (50 mg/kg) for 5 consecutive days beginning 8 days posttransplant in C57BL/6 mice.
Plasma and tissue analysis of transplant recipients.
At the indicated time after transplantation, mice were anesthetized with isoflurane, and a cardiac puncture was performed to collect plasma before cervical dislocation. Pancreas and jejunum (8–10 cm distal to the pylorus) were removed, rinsed in PBS, fixed in 4% paraformaldehyde, and paraffin sectioned at 3 μm. Plasma analytes were measured using total GLP-1 radioimmunoassay, GLP-2 enzyme immunoassay, and/or glucagon enzyme immunoassay kits.
Histology and morphometric analysis.
After antigen retrieval in citrate buffer, pancreas sections were stained using guinea pig anti-insulin (1:900; Linco Research, St. Charles, MO), rabbit anti-glucagon (1:1,800; Sigma), mouse anti–proliferating cell nuclear antigen (PCNA) (1:200; BD Biosciences, San Jose, CA), and secondary antisera conjugated to Alexafluor 488 or 594 (1:800). Total insulin-/glucagon-positive area, as well as the number and average size of insulin-/glucagon-positive clusters, were determined in one section per mouse and normalized for sectional pancreatic area. The proportions of - and -cells per islet were determined by counting nuclei of all glucagon- and insulin-positive cells of five or more randomly selected islets for each mouse. -Cells within two cells of the islet edge were considered "peripheral " and otherwise were considered "central." Some sections were costained for insulin and PCNA, and the number of insulin-positive/PCNA-positive cells was quantified in seven or more randomly selected islets per animal.
Jejunal crypt cell proliferation was assessed using a method described elsewhere (17). Sections were stained for PCNA, and for six or more upright intact crypts per mouse, the first 20 cells extending upward from the crypt base (position 1) were scored as PCNA– or PCNA+. Crypt plus villus height was determined by measuring from the crypt base to the tip of the villus in 4–10 upright intact villi in hematoxylin-stained sections for each mouse.
Statistical analysis.
Data are presented as means ± SE and were analyzed using the Student’s t test or ANOVA with Bonferroni’s post-test as appropriate (P < 0.05, P < 0.01, P < 0.001).
RESULTS
Characterization of -cell lines expressing PC2 or PC1/3.
To study the impact of expression of PC2 versus PC1/3 in the -cell, we used two different -cell lines. Using immunocytochemistry and immunoblotting, we confirmed that TC-1 cells express PC2 (data not shown) but little or no PC1/3; TCPC2 cells, in contrast, express PC1/3 but not bioactive PC2 (Fig. 1A and B). Consistent with minimal PC1/3 expression, TC-1 cells secreted very little GLP-1 compared with PC1/3-expressing TCPC2 cells (Fig. 1C) (6.6 ± 1.7 vs. 276.9 ± 96.0 ng/ml; n 2). However, TC-1 cells secreted 10-fold more glucagon than TCPC2 cells (Fig. 1C) (113.0 ± 9.6 vs. 10.0 ± 1.9 ng/ml; n 2). Thus, these cells allowed us to compare the in vivo effects of transplanting -cells expressing either PC1/3 or PC2.
Transplantation of PC2- or PC1/3-expressing -cells to normal and GLP-1R–/– mice.
We sought to compare the impact of transplantation of PC2-expressing (TC-1) or PC1/3-expressing (TCPC2) -cells in normal mice. TC-1 recipients had slightly increased fasting blood glucose levels during the 14 days after transplant (Fig. 2A) (P = 0.06 at 8 days; P = 0.054 at 12 days; P < 0.05 at 14 days; n 7), whereas blood glucose of TCPC2 recipients was slightly lower than that of sham-operated mice 2 days posttransplant (8.3 ± 0.2 vs. 9.0 ± 0.2 mmol/l, respectively; P < 0.05; n = 8) but not different thereafter. Body weights were not different among the three groups (data not shown).
Glucose handling was assessed using an IPGTT 7 days posttransplant (Fig. 2B). While sham-operated mice and TC-1 recipients behaved similarly, TCPC2 recipients had a dramatic improvement in glucose tolerance, with both lower peak glucose levels (10.0 ± 0.2 vs. 16.7 ± 1.9 mmol/l for sham at 15 min; n 7) and a 41% decrease in area under the curve (AUC) (Fig. 2C). To assess the contribution of GLP-1R signaling to the improved glucose tolerance observed after TCPC2 transplant, we repeated transplant studies in GLP-1R–/– mice and wild-type littermates. GLP-1R+/+ mice receiving TCPC2 cells had a 33% decrease in peak glucose levels and a 25% decrease in AUC in an IPGTT performed 7 days posttransplant (Fig. 2D and F). In contrast, GLP-1R–/– mice receiving TCPC2 cells had a mild decrease in peak glucose and no change in AUC compared with controls (Fig. 2E and F).
Sixteen days posttransplant, CD-1 mice were killed and pancreas tissue collected for histological examination. Sham-operated and TC-1 and TCPC2 recipients had similar total and average insulin-positive area and number of insulin-positive areas (Fig. 3A–E). However, TC-1 recipients had relatively fewer -cells per islet (Fig. 3F) and a trend toward decreased total glucagon-positive area (P = 0.11) owing to decreased average size of glucagon-positive areas (Fig. 3G–I).
Administration of multiple low-dose STZ to mice after TCPC2 or TC-1 cell transplant.
Because transplantation of PC1/3-expressing TCPC2 cells or PC2-expressing TC-1 cells resulted in opposite effects on glucose homeostasis in nondiabetic mice, we sought to examine the impact of TCPC2 or TC-1 cells in a mouse model of type 1 diabetes. C57BL/6 mice received sham surgery or encapsulated TCPC2 or TC-1 cells on day 0, and a low-dose regimen of the -cell toxin STZ was administered from 8–12 days posttransplant. TCPC2 recipients exhibited lower fasting blood glucose levels than sham-operated mice even before STZ was administered, and whereas control mice developed mild diabetes within 10 days of the last dose of STZ, TCPC2 recipients did not progress to diabetes (Fig. 4A). Body weights of control mice and TCPC2 recipients did not differ (Fig. 4B). An IPGTT was performed 7 days post-transplant (before STZ administration), and consistent with our observations in CD-1 mice, TCPC2 recipients exhibited a dramatic improvement in glucose tolerance, with lower blood glucose levels at all time points and a 55.6% decrease in AUC (Fig. 4C). Plasma GLP-1 was measured in blood samples collected just before glucose administration, and whereas GLP-1 was below the level of detection in control mice (<8.9 pg/ml), TCPC2 recipients had plasma GLP-1 levels of 297.7 ± 36.7 pg/ml (n 6). In an oral glucose tolerance test performed 20 days posttransplant (just before STZ-induced diabetes onset), TCPC2 recipients again displayed improved glucose disposal, with lower peak blood glucose values and a 24.9% decrease in AUC (Fig. 4D).
In contrast to TCPC2 recipients, TC-1–transplanted mice had consistently higher blood glucose levels than sham-operated controls following transplant (Fig. 5A). An IPGTT was performed 7 days posttransplant, and unlike TCPC2 recipients, TC-1 recipients exhibited impaired glucose tolerance relative to control mice, with higher peak blood glucose levels and a 53.0% increase in AUC (Fig. 5C). Plasma glucagon was measured in blood samples collected just before glucose administration, and TC-1 recipients had threefold greater glucagon levels than controls (799.6 ± 60.2 pg/ml vs. 246.6 ± 41.2 pg/ml; n = 8; P < 0.001). In response to STZ treatment, TC-1 recipients developed hyperglycemia similar to control mice (Fig. 5A). Finally, an oral glucose tolerance test was performed 20 days posttransplant, and in contrast to TCPC2 recipients, TC-1 recipients did not exhibit improved glucose handling (Fig. 5D).
Plasma and histological analysis of STZ-treated TCPC2 or TC-1 recipient mice.
Mice were killed 30 days posttransplant, and plasma and pancreatic tissue were collected for further analysis. TCPC2-treated mice had threefold higher plasma GLP-1 and 1.8-fold greater plasma GLP-2 levels than sham-operated controls at this time (177.7 ± 56.5 vs. 59.9 ± 12.0 pg/ml for GLP-1, n 5; 1.3 ± 0.2 vs. 0.7 ± 0.02 ng/ml for GLP-2; n 8). TC-1 recipients had 8.3-fold higher plasma glucagon levels than controls (494.6 ± 164.7 vs. 59.77 ± 11.37 pg/ml; n = 8).
Histological examination of the pancreas revealed that sham-operated STZ-treated mice had relatively more -cells and fewer -cells per islet than did TCPC2-transplanted STZ-treated mice (Fig. 6A and B). Sham-operated mice exhibited disrupted islet architecture, with more centrally located -cells, whereas mice receiving TCPC2 cells were protected against this STZ-induced abnormality (28.0 ± 3.2 vs. 15.8 ± 1.6%, respectively; P < 0.01; n 7). TCPC2 recipients tended to have more insulin-positive pancreatic area (P = 0.062) and, on average, larger islets, although the number of islets was unchanged (Fig. 6C–E). TCPC2 recipients also displayed an increased number of replicating (i.e., PCNA+) -cells as a percentage of total -cells (Fig. 6F–G).
STZ-treated TC-1–transplanted mice also displayed relatively fewer -cells and more -cells per islet (Fig. 7A and B). Sham-operated mice had more centrally located -cells than did TC-1 recipients (28.8 ± 1.8 vs. 16.7 ± 2.4% of -cells, respectively; P < 0.01; n 7). However, whereas TC-1 recipients exhibited no change in insulin-positive area, islet size, or islet number relative to sham-operated controls (Fig. 7C–E), they tended to have decreased total glucagon-positive pancreatic area (Fig. 7F; P = 0.068). The average glucagon-positive area per islet was decreased in TC-1 recipients, although the number of glucagon-positive areas was unchanged (Fig. 7G and H). -Cell replication as assessed by insulin/PCNA costaining was not altered in TC-1 recipients relative to controls (data not shown).
We also examined jejunal sections for evidence of possible effects that any TCPC2–or TC-1–derived products might have had on this tissue. Compared with sham-operated controls, TCPC2 recipients displayed increased crypt plus villus height and increased proliferation (i.e., PCNA+ cells) in the region 16–20 cells up from the crypt base (Fig. 8A and B). In contrast, TC-1 recipients displayed no change in crypt plus villus height or crypt cell proliferation compared with their respective controls (Fig. 8C and D).
DISCUSSION
In this study, we compared the effect of transplanting -cells in which proglucagon was processed as normal via PC2 (TC-1) or as in the L-cell via PC1/3 (TCPC2) (Fig. 1). As has been reported previously (18,19), we observed that TC-1 cells express PC2 but not PC1/3 and secrete glucagon but not GLP-1. In contrast, TCPC2 cells, which lack bioactive PC2 (14), expressed abundant levels of PC1/3 and thus produced high levels of GLP-1 but very little glucagon. The upregulation of PC1/3 in the absence of PC2 seems to be specific to this cell line and not a more general feature of loss of function of PC2 in -cells, since there is no apparent induction of PC1/3 expression in the -cells of PC2–/– mice (2,20). Robust PC1/3 expression in TCPC2 cells may reflect developmental arrest induced by transformation at a stage when PC2 and PC1/3 are normally coexpressed in the developing -cell (14,20,21). High glucose culture conditions may have further promoted PC1/3 expression in TCPC2 cells, since hyperglycemia has been shown to increase PC1/3 expression in rodent -cells (22).
Alginate encapsulation provides a means of protecting transplanted cells from host immune attack and has been used to achieve long-term maintenance of transplanted islets in models of diabetes (23,24). We used cell encapsulation to allow us to examine the long-term delivery of PC2- versus PC1/3-derived PGDPs in mice in the absence of immunosuppression. Capsules remained interspersed throughout the intraperitoneal cavity of transplant recipients, although beyond 3–4 weeks posttransplant, capsules occasionally hardened and clumped together. Because at the time of death mice receiving TC-1 or TCPC2 cells still had elevated plasma levels of glucagon and GLP-1, respectively, transplanted cells likely remained viable even 30 days posttransplantation.
CD-1 mice that received transplants of glucagon-producing TC-1 cells displayed increased fasting blood glucose levels, whereas mice that received GLP-1–producing TCPC2 cells exhibited greatly improved glucose tolerance (Fig. 2). Thus, by changing the processing enzyme present in -cells from PC2 to PC1/3, transplanted cells were converted from hyperglycemia promoting to causing a robust improvement in glucose homeostasis, even in normal mice that were not glucose intolerant. Transplantation of TCPC2 cells to GLP-1R–/– mice revealed that the improvement in glucose tolerance observed in normal mice was primarily due to GLP-1R signaling. Given that GLP-1R signaling has been implicated in -cell survival (1,11,25), this finding led us to compare the effect of TC-1 and TCPC2 transplantation in a mouse model of diabetes.
In the low-dose STZ model, sham-operated mice developed hyperglycemia 1–2 weeks after STZ administration, and whereas TCPC2 recipients were protected against diabetes development and had improved glucose tolerance (Fig. 4A), TC-1 recipients developed hyperglycemia along with their respective controls and had impaired glucose tolerance (Fig. 5). Histological examination of the pancreas revealed that TCPC2 recipients had greater insulin-positive area than controls (Fig. 6), whereas TC-1 recipients showed no change compared with controls (Fig. 7). Interestingly, sham-operated mice displayed the disrupted islet architecture typical of the multiple low-dose STZ model (26), whereas TCPC2 recipients did not (Fig. 6). The relative increase in the number of -cells per islet, and the increases in islet area and -cell replication observed in TCPC2-treated mice, suggest that a PC1/3-derived PGDP may have stimulated -cell replication. GLP-1 is the most likely candidate given its known trophic effects on -cell mass (1,11,27). It is possible that GLP-1 produced by the transplanted cells might also have protected islets against STZ-induced apoptosis in the TCPC2 recipients, consistent with GLP-1’s known pro-survival effect on -cells (1,11,25). Further supporting the concept that these effects are mediated by a PC1/3-derived PGDP is the observation that transplanted PC2-expressing TC-1 cells afforded no protection against STZ-induced hyperglycemia and did not induce greater insulin-positive area or -cell proliferation (Fig. 7).
Consistent with our observations in CD-1 mice transplanted with TC-1 cells, TC-1–transplanted C57BL/6 mice displayed increased fasting blood glucose levels even before STZ treatment (Fig. 5). TC-1 transplant in this model also caused impaired glucose tolerance. It is unclear how transplanted TC-1 cells impaired glucose tolerance in C57BL/6 but not CD-1 mice, but it is possible that different genetic backgrounds have different capacities to compensate for hyperglucagonemia. In both models, chronic stimulation of hepatic glucose output by the excessive glucagon coming from the transplanted TC-1 cells may have led to the observed perturbations in blood glucose levels. Consistent with the notion that ectopic glucagon decreased the demand for pancreatic glucagon, TC-1 recipients exhibited -cell hypoplasia in the endogenous pancreas (Figs. 3 and 7). This observation supports previous studies in which -cell atrophy resulted secondary to hyperglucagonemia induced by transplantation of a glucagonoma (28,29) or by glucagon minipump (30). Notably, -cell hypoplasia was absent in CD-1 mice receiving TCPC2 transplants, providing further evidence that this was a compensatory adaptation specific to the PC2 product glucagon.
Disorganization of islet architecture and a relative increase in number of -cells have been widely reported in models of -cell damage or dysfunction (26,31–34). It remains unclear whether these architectural changes reflect true -cell hyperplasia or are an artifact of decreased islet size and the inward collapse of islets as -cells are destroyed. It is also unknown whether this putative change in -cell mass is secondary to hyperglycemia or is directly due to the loss of an intra-islet -cell–derived signal. However, in the current study, TC-1 recipients were protected against STZ-induced disorganization of islet architecture and -cell hyperplasia, even in the face of hyperglycemia. Our studies therefore suggest that hyperglycemia itself is not sufficient to induce islet disorganization and -cell hyperplasia.
In addition to GLP-1, it is likely that TCPC2 cells also produce oxyntomodulin and GLP-2, since these are also products of PC1/3 cleavage and are cosecreted along with GLP-1 from the enteroendocrine L-cell (1,11,35). The observation that TCPC2 transplant improved glucose tolerance in wild-type, but not GLP-1R–/–, mice suggests that GLP-1 coming from the transplanted cells is the primary PC1/3-derived proglucagon product that mediates this effect. However, since GLP-1R–/– mice receiving TCPC2 cells had lower blood glucose than controls 15 min after glucose delivery, some other product of TCPC2 cells may also have beneficial effects on glucose handling. Oxyntomodulin has been reported to stimulate insulin secretion (36,37) and thus is a potential candidate contributing to glucose-lowering effects, although such actions might also be mediated in part through the GLP-1 receptor (38).
STZ-treated TCPC2 recipients had increased plasma GLP-2 levels relative to controls and hyperplasia of the intestinal epithelium (Fig. 8A and B). Notably, these effects were absent in mice that received TC-1 cells, which lack the capacity for GLP-2 production (Fig. 8C and D). Our observations in TCPC2 recipient mice are consistent with the known role of GLP-2 as a proliferative factor for intestinal enterocytes (11,39,40) and agree with a recent study in which injection of a GLP-2 analog resulted in greater proliferation in the "rapidly proliferating transit zone" defined by cells 11–20 of the jejunal crypts (17). Since a role for GLP-2 in promotion of -cell function or survival has not been described (41) and since the GLP-2 receptor has not been localized to the -cell (42), we consider it unlikely that GLP-2 acted directly on the -cell to contribute significantly to the phenotype of TCPC2 recipient mice.
In summary, these studies demonstrate that simply switching the PC profile in proglucagon-expressing cells can render them either glucose raising (PC2) or glucose lowering (PC1/3). Transplantation of GLP-1–producing TCPC2 cells prevented STZ-induced hyperglycemia, which supports the growing body of evidence suggesting that long-term activation of the GLP-1 receptor in mice promotes -cell survival and proliferation (25,43,44). We have recently shown that delivery of PC1/3 to islets induces GLP-1 production, improves islet function and survival, and enhances islet transplantation outcomes in STZ-treated mice (45). The current work provides additional evidence that modulation of proglucagon processing in the -cell promotes the release of a beneficial profile of PGDPs and could be useful for diabetes therapy. Moreover, TCPC2 cells provide a model system for studying alternate proglucagon processing and examining the impact of continuous delivery of PC1/3-derived proglucagon products.
【参考文献】
Kieffer TJ, Habener JF: The glucagon-like peptides. Endocr Rev 20:876–913, 1999
Furuta M, Zhou A, Webb G, Carroll R, Ravazzola M, Orci L, Steiner DF: Severe defect in proglucagon processing in islet A-cells of prohormone convertase 2 null mice. J Biol Chem 276:27197–27202, 2001
Rouille Y, Bianchi M, Irminger JC, Halban PA: Role of the prohormone convertase PC2 in the processing of proglucagon to glucagon. FEBS Lett 413:119–123, 1997
Unger RH: Glucagon in pathogenesis of diabetes (Letter). Lancet 1:1036–1032, 1975
Sorensen H, Brand CL, Neschen S, Holst JJ, Fosgerau K, Nishimura E, Shulman GI: Immunoneutralization of endogenous glucagon reduces hepatic glucose output and improves long-term glycemic control in diabetic ob/ob mice. Diabetes 55:2843–2848, 2006
Sloop KW, Cao JX, Siesky AM, Zhang HY, Bodenmiller DM, Cox AL, Jacobs SJ, Moyers JS, Owens RA, Showalter AD, Brenner MB, Raap A, Gromada J, Berridge BR, Monteith DK, Porksen N, McKay RA, Monia BP, Bhanot S, Watts LM, Michael MD: Hepatic and glucagon-like peptide-1-mediated reversal of diabetes by glucagon receptor antisense oligonucleotide inhibitors. J Clin Invest 113:1571–1581, 2004
Shah P, Vella A, Basu A, Basu R, Schwenk WF, Rizza RA: Lack of suppression of glucagon contributes to postprandial hyperglycemia in subjects with type 2 diabetes mellitus. J Clin Endocrinol Metab 85:4053–4059, 2000
Petersen KF, Sullivan JT: Effects of a novel glucagon receptor antagonist (Bay 27-9955) on glucagon-stimulated glucose production in humans. Diabetologia 44:2018–2024, 2001
Rouille Y, Kantengwa S, Irminger JC, Halban PA: Role of the prohormone convertase PC3 in the processing of proglucagon to glucagon-like peptide 1. J Biol Chem 272:32810–32816, 1997
Zhu X, Zhou A, Dey A, Norrbom C, Carroll R, Zhang C, Laurent V, Lindberg I, Ugleholdt R, Holst JJ, Steiner DF: Disruption of PC1/3 expression in mice causes dwarfism and multiple neuroendocrine peptide processing defects. Proc Natl Acad Sci U S A 99:10293–10298, 2002
Drucker DJ: The biology of incretin hormones. Cell Metab 3:153–165, 2006
Wynne K, Bloom SR: The role of oxyntomodulin and peptide tyrosine-tyrosine (PYY) in appetite control. Nat Clin Pract Endocrinol Metab 2:612–620, 2006
Meier JJ, Nauck MA, Pott A, Heinze K, Goetze O, Bulut K, Schmidt WE, Gallwitz B, Holst JJ: Glucagon-like peptide 2 stimulates glucagon secretion, enhances lipid absorption, and inhibits gastric acid secretion in humans. Gastroenterology 130:44–54, 2006
Webb GC, Dey A, Wang J, Stein J, Milewski M, Steiner DF: Altered proglucagon processing in an alpha-cell line derived from prohormone convertase 2 null mouse islets. J Biol Chem 279:31068–31075, 2004
Scrocchi LA, Brown TJ, MaClusky N, Brubaker PL, Auerbach AB, Joyner AL, Drucker DJ: Glucose intolerance but normal satiety in mice with a null mutation in the glucagon-like peptide 1 receptor gene. Nat Med 2:1254–1258, 1996
Flamez D, Van Breusegem A, Scrocchi LA, Quartier E, Pipeleers D, Drucker DJ, Schuit F: Mouse pancreatic beta-cells exhibit preserved glucose competence after disruption of the glucagon-like peptide-1 receptor gene. Diabetes 47:646–652, 1998
Anini Y, Izzo A, Oudit GY, Backx PH, Brubaker PL: Role of phosphatidylinositol-3 kinase-gamma in the actions of glucagon-like peptide-2 on the murine small intestine. Am J Physiol Endocrinol Metab 292:E1599–E1606, 2007
Rouille Y, Westermark G, Martin SK, Steiner DF: Proglucagon is processed to glucagon by prohormone convertase PC2 in alpha TC1–6 cells. Proc Natl Acad Sci U S A 91:3242–3246, 1994
Dhanvantari S, Brubaker PL: Proglucagon processing in an islet cell line: effects of PC1 overexpression and PC2 depletion. Endocrinology 139:1630–1637, 1998
Vincent M, Guz Y, Rozenberg M, Webb G, Furuta M, Steiner D, Teitelman G: Abrogation of protein convertase 2 activity results in delayed islet cell differentiation and maturation, increased alpha-cell proliferation, and islet neogenesis. Endocrinology 144:4061–4069, 2003
Wilson ME, Kalamaras JA, German MS: Expression pattern of IAPP and prohormone convertase 1/3 reveals a distinctive set of endocrine cells in the embryonic pancreas. Mech Dev 115:171–176, 2002
Nie Y, Nakashima M, Brubaker PL, Li QL, Perfetti R, Jansen E, Zambre Y, Pipeleers D, Friedman TC: Regulation of pancreatic PC1 and PC2 associated with increased glucagon-like peptide 1 in diabetic rats. J Clin Invest 105:955–965, 2000
Duvivier-Kali VF, Omer A, Lopez-Avalos MD, O’Neil JJ, Weir GC: Survival of microencapsulated adult pig islets in mice in spite of an antibody response. Am J Transplant 4:1991–2000, 2004
Suzuki K, Bonner-Weir S, Trivedi N, Yoon KH, Hollister-Lock J, Colton CK, Weir GC: Function and survival of macroencapsulated syngeneic islets transplanted into streptozocin-diabetic mice. Transplantation 66:21–28, 1998
Li Y, Hansotia T, Yusta B, Ris F, Halban PA, Drucker DJ: Glucagon-like peptide-1 receptor signaling modulates beta cell apoptosis. J Biol Chem 278:471–478, 2003
Li Z, Karlsson FA, Sandler S: Islet loss and alpha cell expansion in type 1 diabetes induced by multiple low-dose streptozotocin administration in mice. J Endocrinol 165:93–99, 2000
Wang Q, Brubaker PL: Glucagon-like peptide-1 treatment delays the onset of diabetes in 8 week-old db/db mice. Diabetologia 45:1263–1273, 2002
Drucker DJ, Lee YC, Asa SL, Brubaker PL: Inhibition of pancreatic glucagon gene expression in mice bearing a subcutaneous glucagon-producing GLUTag transplantable tumor. Mol Endocrinol 6:2175–2184, 1992
Ehrlich P, Tucker D, Asa SL, Brubaker PL, Drucker DJ: Inhibition of pancreatic proglucagon gene expression in mice bearing subcutaneous endocrine tumors. Am J Physiol 267:E662–E671, 1994
Webb GC, Akbar MS, Zhao C, Swift HH, Steiner DF: Glucagon replacement via micro-osmotic pump corrects hypoglycemia and -cell hyperplasia in prohormone convertase 2 knockout mice. Diabetes 51:398–405, 2002
Weir GC, Atkins RF, Martin DB: Glucagon secretion from the perfused rat pancreas following acute and chronic streptozotocin. Metabolism 25:1519–1521, 1976
Weir GC, Knowlton SD, Atkins RF, McKennan KX, Martin DB: Glucagon secretion from the perfused pancreas of streptozotocin-treated rats. Diabetes 25:275–282, 1976
Guz Y, Nasir I, Teitelman G: Regeneration of pancreatic beta cells from intra-islet precursor cells in an experimental model of diabetes. Endocrinology 142:4956–4968, 2001
Jones CW, Reynolds WA, Hoganson GE: Streptozotocin diabetes in the monkey: plasma levels of glucose, insulin, glucagon, and somatostatin, with corresponding morphometric analysis of islet endocrine cells. Diabetes 29:536–546, 1980
Dhanvantari S, Seidah NG, Brubaker PL: Role of prohormone convertases in the tissue-specific processing of proglucagon. Mol Endocrinol 10:342–355, 1996
Jarrousse C, Bataille D, Jeanrenaud B: A pure enteroglucagon, oxyntomodulin (glucagon 37), stimulates insulin release in perfused rat pancreas. Endocrinology 115:102–105, 1984
Schjoldager BT, Baldissera FG, Mortensen PE, Holst JJ, Christiansen J: Oxyntomodulin: a potential hormone from the distal gut: pharmacokinetics and effects on gastric acid and insulin secretion in man. Eur J Clin Invest 18:499–503, 1988
Baggio LL, Huang Q, Brown TJ, Drucker DJ: Oxyntomodulin and glucagon-like peptide-1 differentially regulate murine food intake and energy expenditure. Gastroenterology 127:546–558, 2004
Bjerknes M, Cheng H: Modulation of specific intestinal epithelial progenitors by enteric neurons. Proc Natl Acad Sci U S A 98:12497–12502, 2001
Drucker DJ, Erlich P, Asa SL, Brubaker PL: Induction of intestinal epithelial proliferation by glucagon-like peptide 2. Proc Natl Acad Sci U S A 93:7911–7916, 1996
Schmidt WE, Siegel EG, Creutzfeldt W: Glucagon-like peptide-1 but not glucagon-like peptide-2 stimulates insulin release from isolated rat pancreatic islets. Diabetologia 28:704–707, 1985
Yusta B, Huang L, Munroe D, Wolff G, Fantaske R, Sharma S, Demchyshyn L, Asa SL, Drucker DJ: Enteroendocrine localization of GLP-2 receptor expression in humans and rodents. Gastroenterology 119:744–755, 2000
Soltani N, Kumar M, Glinka Y, Prud’homme GJ, Wang Q: In vivo expression of GLP-1/IgG-Fc fusion protein enhances beta-cell mass and protects against streptozotocin-induced diabetes. Gene Ther 14:981–988, 2007
Kumar M, Hunag Y, Glinka Y, Prud’homme GJ, Wang Q: Gene therapy of diabetes using a novel GLP-1/IgG1-Fc fusion construct normalizes glucose levels in db/db mice. Gene Ther 14:162–172, 2007
Wideman RD, Yu IL, Webber TD, Verchere CB, Johnson JD, Cheung AT, Kieffer TJ: Improving function and survival of pancreatic islets by endogenous production of glucagon-like peptide 1 (GLP-1). Proc Natl Acad Sci U S A 103:13468–13473, 2006
订阅登记：
请您在下面输入常用的Email地址、职业以便我们定期通过邮箱发送给您最新的相关医学信息，感谢您浏览首席医学网！