首席网期刊频道
您所在位置: 首页 > 期刊 > 过刊浏览 > 基础医学与生物医学工程> 《生物物理学杂志》> 2005年3月280卷3期>文章精华> 文章详情

The Islet Cell-enriched MafA Activator Is a Key Regulator of Insulin Gene Transcription

首席医学网      2008年08月15日 13:52:14 Friday  
 

作者:Li Zhao,Min Guo,Taka-aki Matsuoka,Derek K. Hagman,Susan D. Parazzoli,Vincent Poitout, Roland Stein    作者单位:Department of Molecular Physiology and Biophysics, Vanderbilt University School of Medicine, Nashville, Tennessee 3723 the Pacific Northwest Research Institute, Seattle, Washington 9812 and the Department of Medicine, University of Washington, Seattle, Washington 98195

  加入收藏夹

【摘要】  The islet-enriched MafA, PDX-1, and BETA2 activators contribute to both cell-specific and glucose-responsive insulin gene transcription. To investigate how these factors impart activation, their combined impact upon insulin enhancer-driven expression was first examined in non- cell line transfection assays. Individual expression of PDX-1 and BETA2 led to little or no activation, whereas MafA alone did so modestly. MafA together with PDX-1 or BETA2 produced synergistic activation, with even higher insulin promoter activity found when all three proteins were present. Stimulation was attenuated upon compromising either MafA transactivation or DNA-binding activity. MafA interacted with endogenous PDX-1 and BETA2 in coimmunoprecipitation and in vitro GST pull-down assays, suggesting that regulation involved direct binding. Dominant-negative acting and small interfering RNAs of MafA also profoundly reduced insulin promoter activity in cell lines. In addition, MafA was induced in parallel with insulin mRNA expression in glucose-stimulated rat islets. Insulin mRNA levels were also elevated in rat islets by adenoviral-mediated expression of MafA. Collectively, these results suggest that MafA plays a key role in coordinating and controlling the level of insulin gene expression in islet cells.

【关键词】  Cellenriched Activator Regulator Transcription


INTRODUCTION


Insulin is selectively expressed in the pancreatic cells of the islet of Langerhans. Restricted expression is due to a unique combination of factors that stimulate through conserved enhancer region sequences located approximately between nucleotides -340 and -90 relative to the transcription start site (1-4). Detailed analysis has revealed that activation is primarily controlled by PAX6, PDX-1, MafA, and BETA2 binding to the C2 (-317 to -311 bp), A3 (-201 to -196 bp), C1 (-126 to -101 bp), and E1 (-100 to -91 bp) elements, respectively (5, 6). These distinct factors are enriched in islet cells, with BETA2 (7, 8) and PAX6 (9) present in all islet cell types, PDX-1 in and a subset of cells (10), and only the recently isolated MafA protein exclusively in cells (11-13). Although MafA appears to be the major regulator of C1-mediated activation (11-13), the closely related MafB protein is found in a fraction of islet cells in vivo and is capable of activating insulin transcription in vitro (13). PDX-1, MafA, and BETA2 also control glucose-regulated transcription of the insulin gene, the principal metabolic regulator of cell function (8, 14-17).


Gene ablation experiments performed in mice on pax6, pdx-1, and BETA2 have established a critical function for each in pancreatic development. Thus, PDX-1 is essential for the growth of the endocrine and exocrine compartments, with pancreatic development arresting at the early post-bud stage in homozygous pdx-1 mutant mice, resulting in pancreatic agenesis (18, 19). In contrast, the loss of PAX6 and BETA2 affects only islet cell development, with the number of cells dramatically reduced in pax6 gene knock-out mice (9), and a severe, but general loss in total islet cell number in the absence of BETA2 (7, 8). Human heterozygous carriers of dysfunctional mutations in PAX6 (20), BETA2 (21), and PDX-1 (22) also contribute to the development of type 2 diabetes, presumably due to direct effects on the transcription of genes associated with cell identity (i.e. -glucokinase, islet amyloid polypeptide, glucose transporter type 2, as well as insulin (23-28)). Unfortunately, the role MafA plays in cell development has not been determined. However, a significant part is strongly suggested by the exclusive presence of MafA in developing islet insulin producing cells and adult islet cells (13, 29), its importance in pdx-1 (30) and insulin gene transcription (11-13, 29), and the general association of proteins in the large Maf family with developmental processes (i.e. MafB (31), c-Maf (32, 33), and NRL (34)).


Islet-enriched activator binding promotes the assembly of the insulin transcription complex. This process is mediated by interactions between activators themselves and by contact with the RNA polymerase II transcriptional apparatus, or indirectly through bridging coactivators. Thus, PDX-1 and BETA2 binding to the p300 coactivator or its paralogue p300/cAMP response element binding protein-binding protein (CBP)1 provides a docking and recruitment interface with the general transcriptional machinery (27, 35, 36). In this study, MafA was found to functionally interact with PDX-1 and BETA2 to promote synergistic activation of insulin enhancer-driven reporter activity in non- cells. MafA was also shown to play a direct and principal role in insulin gene activation in cell lines, although p300/CBP was not involved in this response. In addition, insulin mRNA levels were found to increase in conjunction with MafA in rat islets. Our results suggest that MafA-mediated signaling is important for high level expression of the insulin gene in cells.


MATERIALS AND METHODS


DNA Constructs-The -238 insulin-firefly luciferase (LUC) expression plasmids contain wild-type rat insulin II gene sequences from bp -238 to +2 and PDX-1 (A3 and A1 (37)), BETA2 (E1 (38)), or MafA (C1 (29)) binding mutations. The construction of the cytomegalovirus (CMV) enhancer-driven MafA (13), PDX-1 (39), and BETA2 (36) expression vectors was described previously. MafA135-359 was made by PCR from wild type mouse MafA and subcloned into the polylinker of the CMV-driven expression vector, pcDNA3.1/Zeo(+) (Invitrogen). The arginine to alanine mutant at amino acid 265 in MafA was constructed in the CMV:MafA 1-359 vector using the QuikChangeTM site-directed mutagenesis kit (top: 5'-CCGACTGAAACAGAAGGCGCGCACGCTCAAG-3'; the mutated nucleotides are underlined) (Stratagene). GST:MafA chimeras of full-length, amino acids (aa) 1-233, and aa 233-359 of mouse MafA were generated by in-frame fusion with the glutathione S-transferase (GST) coding sequences in the pGEM-KG bacterial expression vector (Amersham Biosciences). The Gal4:MafA chimeras containing sequences from aa 1-359 (i.e. full-length) or aa 1-233 were constructed by subcloning PCR-amplified mouse MafA fragments into pSG424 (40) to create in-frame GAL4 DNA binding domain:MafA fusion proteins. The construction of the GAL4:BETA2 constructs containing the hamster full-length (1-355) or aa 156-355 of BETA2 were described previously (36). The CMV-driven wild type and p300 dl10 mutant (deletion of aa 1680-1811) have also been described (41). The adenovirus type 5 E1A expression plasmid encodes for the wild type 243-aa protein. The adenovirus-5 expressing MafA under the control of the CMV enhancer/promoter (AdV-CMV) was generated using the mouse MafA cDNA as described previously (42). The correctness of each construct was verified by restriction enzyme digestion and DNA sequence analysis.


Small interfering RNAs (siRNA) of MafA were expressed from the RNA polymerase III H1 gene promoter in the pSUPER mammalian expression vector (43). The targeted regions of murine MafA mRNA were selected using the online program available from Ambion Inc. (www.ambion.com/techlib/misc/siRNA_finder.html), and labeled relative to the nucleotides spanned from the ATG translation start codon. The following oligonucleotides were used for cloning into pSUPER (the MafA sequences are underlined): +64/+84 bp, 5'-GATCCCCAACGACTTCGACCTGATGAAGTTCAAGAGACTTCATCAGGTCGAAGTCGTTTTTTTGGAAA-3'; +82/+102, 5'-GATCCCCAAGTTCGAGGTGAAGAAGGAGTTCAAGAGACTCCTTCTTCACCTCGAACTTTTTTTGGAAA-3'; +955/+975, 5'-GATCCCCAAATACGAGAAGTTGGCGGGCTTCAAGAGAGCCCGCCAACTTCTCGTATTTTTTTTGGAAA-3'; +1054/+1074, 5'-GATCCCCAAAGGCGCACCCGACTTCTTTTTCAAGAGAAAAGAAGTCGGGTGCGCCTTTTTTTTGGAAA-3'.


Cell Line Transfections and Rat Islet Isolation-The non- (HeLa and HEK293) and (TC3 and MIN6) cell lines were grown in Dulbecco's modified Eagle's medium in the presence of 10% heat-inactivated fetal calf serum, 25 mM glucose, penicillin (100 units/ml), and streptomycin (100 µg/ml). Insulin -238 LUC (0.25 µg) was transfected with MafA, PDX-1, and/or BETA2 expression vectors (0.25 µg/each) using the Lipofectamine procedure (Invitrogen). The CMV-driven Renilla luciferase expression plasmid phRL-TK (Promega) was used as a recovery marker (2 ng), with 1 µg of total DNA used for each point. The Dual Luciferase assay (Promega) was performed 40-48 h after transfection according to the manufacturer's directions. Each experiment was repeated at least four times using at least two different plasmid preparations.


Rat islets were isolated by collagenase digestion from 6-week-old male Wistar rats (Harlan Sprague-Dawley, Indianapolis, IL) as described previously (44). After an overnight culture in RPMI 1640 containing 10% heat-inactivated fetal bovine serum, 100 units/ml penicillin, 100 µg/ml streptomycin, and 11 mM glucose, the islets were resuspended in fresh medium and incubated at 37 °C under the experimental conditions described in the figure legend.


Immunoprecipitation and Western Blotting-TC3 cells were lysed in radioimmune precipitation assay buffer (10 mM Tris-HCl, pH 8.0, 140 mM NaCl, 0.025% NaN3, 0.5% Triton X-100, 1% sodium deoxycholate, 0.1% SDS, 1 mM phenylmethylsulfonyl fluoride, 2 µg of aprotinin per milliliter), whereas rat islets were sonicated in ice-cold cell lysis buffer (50 mM HEPES (pH 7.5), 1% (v/v) Nonidet P-40, 2 mM activated sodium orthovanadate, 100 mM sodium fluoride, 10 mM sodium pyrophosphate, 4 mM EDTA, 1 mM phenylmethylsulfonyl fluoride, 1 µg/ml leupeptin, 1 µg/ml aprotinin). Cellular debris was removed from the lysed islet samples by centrifugation (14,000 rpm, 10 min, 4 °C). Extract protein was incubated overnight at 4 °C with normal rabbit immunoglobulin G (IgG) or affinity-purified anti-MafA peptide antiserum (Bethyl Laboratories, Inc., Montgomery, TX (13)). The proteins were immunoprecipitated with protein A-Sepharose beads (Sigma), washed three times with radioimmune precipitation assay buffer, subjected to SDS-polyacrylamide gel electrophoresis, and then electrotransferred onto Immobilon polyvinylidene difluoride membrane (Millipore, Bedford, MA). The blot was incubated for 1 h at 4 °C in blocking buffer (10 mM Tris, pH 8.0, 150 mM NaCl, 0.05% Tween 20, and 5% nonfat dry milk) and then at 4 °C overnight with either PDX-1, BETA2 (Santa Cruz Biotechnology Inc.), MafA (Bethyl Laboratories, TX), and TATA-binding protein (Santa Cruz Biotechnology Inc.) antiserum. The PDX-1 polyclonal antiserum was developed to N-terminal region (aa 1-75) epitopes (39). In the MafA siRNA experiment in 293 cells, lysates from CMV:MafA (100 ng)- and MafA siRNA-pSUPER (1 µg)-transfected cells were blotted and analyzed using anti-MafA antiserum. Antibody detection was performed using enhanced chemiluminescence (Pierce Biotechnology) after incubation with a horseradish peroxidase-conjugated secondary antibody.


In Vitro Translation and GST Binding Assays-GST:MafA 1-359, GST:MafA 1-233, and GST:MafA 233-359 fusion proteins were prepared as specified by the manufacturer (Amersham Biosciences). Translation reactions were performed using the TNT in vitro translation kit (Promega, Madison, WI.) with CMV:PDX-1, CMV:BETA2, and L-[35S]methionine. Labeled proteins were incubated with GST:MafA coupled to glutathione-Sepharose beads (Amersham Biosciences) for 1 h in binding buffer (50 mM Tris·HCl, pH 8.0, 150 mM NaCl, 0.1% Nonidet P-40, 2 mM EDTA, 10 mM MgCl2, 20 µM ZnCl2). The beads were washed four times with binding buffer, and the bound protein complexes were eluted with 1x gel loading buffer (50 mM Tris-HCl (pH 6.8), 100 mM dithiothreitol, 2% SDS, 0.1% bromphenol blue, 10% glycerol), resolved by SDS-10% polyacrylamide gel electrophoresis, and visualized by fluorography.


Electrophoretic Mobility Shift Assay-Batches of 350-500 islets each were washed in phosphate-buffered saline, resuspended in 400 µl of cold hypotonic buffer (10 mM HEPES (pH 7.9), 10 mM KCl, 1.5 mM MgCl2, 0.5 mM dithiothreitol, 0.1 mM EDTA, 0.1 mM EGTA, 0.5 mM phenylmethylsulfonyl fluoride, 0.5 µg/ml aprotinin, 10 µg/ml leupeptin, 1 µg/ml pepstatin), and allowed to swell on ice for 15 min before adding 25 µl of 10% (w/v) Nonidet P-40. After vortexing vigorously, the nuclei were pelleted by centrifugation (14,000 rpm, 1 min, and 4 °C) and resuspended in 50 µl of high salt buffer (20 mM HEPES (pH 7.9), 0.4 M NaCl, 0.2 mM dithiothreitol, 0.1 mM EDTA, 0.1 mM EGTA, 1 mM phenylmethylsulfonyl fluoride, 0.5 µg/ml aprotinin, 10 µg/ml leupeptin, and 1 µg/ml pepstatin) (17). Gel shift binding reactions (20 µl) were conducted with 5-10 µg of nuclear extract protein and radiolabeled probe at room temperature for 30 min in the binding buffer (5% (v/v) glycerol, 1 mM EDTA, 50 mM NaCl, 10 mM Tris-HCl pH 7.5, 1 mM dithiothreitol, 0.5 µg/µl poly(dI-dC)). Double-stranded oligonucleotide probes corresponding to the rat insulin II C1 (-126 TGGAAACTGCAGCTTCAGCCCCTCT -101) and E1 (-104 TCTGGCCATCTGCTGGATCCT -85) elements were annealed and labeled by end filling with the DNA Polymerase Large (Klenow) Fragment Kit (Promega) and [-32P]dCTP (PerkinElmer Life Sciences). The identities of the MafA- and BETA2-containing complexes were determined by wild type element competition as well as super-shift analyses with -MafA antisera. The binding complexes were resolved by electrophoretic separation on a 4.5% non-denaturing polyacrylamide gel and visualized by autoradiography.


Measurement of Preproinsulin mRNA Levels-Duplicate batches of 100 islets each were infected overnight with 105 plaque-forming units per islet of the CMV-driven MafA (AdV-MafA) or the firefly luciferase (AdV-Luc (45)) control adenovirus in RPMI 1640 containing 10% fetal bovine serum and 11.1 mM glucose. Islets were then transferred to fresh RPMI 1640 containing 10% fetal bovine serum and 16.7 mM glucose, and incubated at 37 °C for 72 h. Total cellular RNA was isolated using the TRIzol reagent (Invitrogen) and treated with the MessageClean kit to remove DNA (Gene Hunter Corp., Nashville, TN). The ribonuclease protection assay (RPA) was carried out with a 360-bp sequence of the rat II preproinsulin gene and a conserved 245-bp sequence of the mouse -actin gene using the Direct Protect Lysate RPA kit (Ambion, Austin, TX) (42), with the TaqMan-based reverse transcription-PCR performed using oligonucleotides to the rat preproinsulin II and -actin coding sequences described previously (45). This analysis was conducted with several independently treated islet preparations.


Statistical Analysis-The significance of the experimental findings was determined using analysis of variance with the least significance difference test (SAS9.1 statistical software, SAS Institute Inc, Carry, NC). A p value of significant.


RESULTS


MafA Cooperates with PDX-1 and BETA2 to Induce Insulin-driven Transcription-Preventing PDX-1, BETA2, or MafA binding drastically reduces insulin enhancer-driven expression in cells, suggesting that these factors act in a synergistic fashion to mediate transcription. Although the exact mechanisms involved in control are unclear, experiments performed in non- cells imply that PDX-1 and BETA2 act together to cooperatively activate expression, a process augmented by the non-DNA binding p300 coactivator (27, 35, 36). Interestingly, MafA was recently shown to be the only islet-enriched transcription factor that is first expressed in the insulin-producing progenitors that eventually populate the islet (29). In contrast, PDX-1 and BETA2 are synthesized earlier and in a broader range of islet-hormone-producing cell types (8, 10, 19, 46). MafA is also capable of independently inducing endogenous insulin gene expression in an islet cell line (TC-6 (29)). These data imply that MafA serves a unique role in mediating insulin gene expression.


To test if MafA functionally interacts with other islet-enriched insulin activators, PDX-1 and BETA2 expression constructs were cotransfected with MafA and insulin enhancer/promoter-driven -238 LUC reporter constructs. These experiments were conducted in HeLa cells, a non-pancreatic cell line that does not produce insulin or islet-enriched transcription factors. As expected, wild type -238 LUC activity was not influenced by either PDX-1 or BETA2 alone (35), with MafA able to independently stimulate 20-fold (Fig. 1) (13). Transactivation was stimulated in a synergistic manner when MafA was combined with either PDX-1 (Fig. 1B) or BETA2 (Fig. 1C). Additional enhancement of insulin-driven activity was also observed in the presence of all three factors (Fig. 1D). In general, PDX-1-, BETA2-, and MafA-mediated stimulation was dependent upon activator binding, because cooperativity with MafA was essentially lost in the PDX-1 (Fig. 1B, compare -238 WT responsiveness to the A3 and A1 mutants) and BETA2 (Fig. 1C) binding site mutants, whereas activation by MafA was greatly reduced in the C1 mutant (Fig. 1D). Cooperativity was also attenuated in MafA mutants deficient in activation (i.e. MafA 135-359) or DNA-binding domain (MafA R265A) function (Fig. 1E).


FIG. 1.


The actions of MafA, PDX-1, and BETA2 lead to cooperative activation of insulin-driven expression. A, schematic of the rat insulin II control region in -238 WT LUC showing the location of the PDX-1 (A3, -216/-207 bp; A1, -81/-77 bp), BETA2 (E1, -100/-91 bp), and MafA (C1, -115/-107 bp) control elements. B-D, HeLa cells were transfected with MafA (0.25 µg), PDX-1 (0.25 µg), and/or BETA2 (0.25 µg) expression vectors in the presence of wild type (WT) or dysfunctional binding mutants of PDX-1 (B), BETA2 (C), or MafA (D) in -238 LUC (0.25 µg). The low relative level of cooperativity observed in -238 mC1 in D is likely mediated through a poorer MafA binding site, like MR2 (29). The firefly luciferase activity of -238 LUC was normalized to a cotransfected Renilla luciferase control gene, phRL-TK Renilla luciferase (2 ng). The -fold stimulation (± S.E.) is calculated as normalized -238 LUC activity plus effector(s) divided by -238 LUC activity plus pcDNA3.1. *, p versus MafA alone. E, HeLa cells were transfected with -238 LUC (0.25 µg) and wild type (WT) or dysfunctional MafA mutants (0.25 µg), PDX-1 (0.25 µg), and/or BETA2 (0.25 µg) expression vectors. MafA 135-359 has very low activation potential due to deletion of most of the N-terminal activation domain, whereas gel shift DNA-binding activity is significantly reduced upon mutation of a basic region arginine to alanine in MafA R265A (data not shown). *, p versus MafA alone.


MafA, PDX-1, and BETA2 had the same influence on insulin-driven expression in non-islet baby hamster kidney and NIH 3T3 cell lines (data not shown). Together, these results imply that binding of MafA to the insulin enhancer profoundly impacts upon the transcriptional potentiation properties of other key activators, like PDX-1 and BETA2.


MafB Can Act with PDX-1 and BETA2 to Stimulate Insulin Gene Expression-MafB appears to be the only other member of the large Maf family normally expressed in islet cells (13). Unlike MafA, the MafB protein is predominately expressed in adult islet cells (Ref. 13 and data not shown). However, MafB is also detected with MafA in the insulin-producing cells formed during the second and predominant phase of cell formation, as well as glucagon-producing cells during pancreas organogenesis.2 Transfection studies performed with MafB, PDX-1, BETA2, and -238 WT LUC in HeLa cells demonstrated that this closely related large Maf protein also acts effectively with PDX-1 and BETA2 to stimulate insulin gene expression (Fig. 2). The variation in-fold activation between MafA and MafB reflects their different MafA (13, 47)) and not the amount of large Maf activator produced within the experiment (data not shown). These data imply that both MafA and MafB can influence insulin transcription in islet cell progenitors. Because such cells are rare and unavailable for in vitro analysis, the studies below principally focused on determining the significance of MafA in insulin gene expression in islet cell lines, an islet cell model wherein only MafA is found (13).


FIG. 2.


MafB potentiates PDX-1- and BETA2-mediated transactivation of -238 WT. MafA activation of -238 WT LUC was compared with MafB in the presence of the listed effectors in HeLa cells. The normalized -fold activation ± S.E. was calculated as described in the legend to Fig. 1. *, p versus MafA or MafB alone.


MafA Binds Directly to PDX-1 and BETA2-Immunoprecipitation assays were performed in TC-3 cell extracts with MafA antiserum. Western blotting revealed that PDX-1 and BETA2 were coprecipitated with MafA (Fig. 3A). These complexes appear to be specific, because rabbit IgG did not precipitate either PDX-1 or BETA2. Interactions between MafA, PDX-1, and BETA2 were also detected in cell precipitation assays conducted with PDX-1 and BETA2 antisera.


FIG. 3.


MafA binds to PDX-1 and BETA2 in vivo. A, immunoprecipitation (IP) analysis was performed with TC-3 extracts and anti-MafA antisera or rabbit IgG (rIgG); the precipitates were Western-blotted (WB) with (left, top) anti-PDX-1 or (right, top) anti-BETA2 antibody. We also perform the IP with either anti-PDX-1 (left, bottom) or anti-BETA2 antibody (right, bottom) and WB with MafA antisera. The input illustrates the levels of PDX-1, BETA2 or MafA in 2% of the cell extract. B, radiolabeled (top) PDX-1 and (middle) BETA2 were incubated with purified GST control and GST: MafA fusion proteins bound to glutathione-Sepharose beads. Bound PDX-1 or BETA2 was then eluted, separated by 10% SDS-polyacrylamide gel electrophoresis, and detected by autoradiography. The input lane represents the volume fraction used in the binding assay. Bottom, the asterisk denotes the location of the GST:MafA chimera in a Coomassie Blue-stained 10% SDS-polyacrylamide gel.


To test if MafA directly interacted with PDX-1 and BETA2, the binding properties of these factors to GST:MafA affinity columns was analyzed under conditions in which the full-length, N-terminal activation (aa 1-233), and C-terminal DNA-binding/dimerization (aa 233-359) regions of MafA served as ligands. Both PDX-1 and BETA2 bound effectively to the full-length and C-terminal region columns, whereas less binding was detected in the eluates from the GST or GST:MafA 1-233 column (Fig. 3B). Together, these results demonstrated that MafA can directly bind to BETA2 and PDX-1 in vivo.


MafA Is Important for Insulin Expression in Cell Lines-The observation that MafA functionally and physically interacts with PDX-1 and BETA2 implies a pivotal role in promoting insulin transcription. If so, then reducing the functional levels of the activator should profoundly influence insulin gene expression in cells. To test this proposal, MafA activity in the mouse TC-3 and MIN6 cell lines was suppressed by expression of either a dominant-negative-acting form of MafA (MafA135-359) or siRNAs to MafA. The influence of these MafA effectors on -238 WT LUC activity was compared with a MafA site-debilitating mutant within this insulin-driven construct (i.e. C1 mutant).


MafA135-359, which lacks the N-terminal activation domain of this basic leucine-zipper containing DNA binding factor, markedly reduced -238 WT activity (Fig. 4A). Wild type MafA also slightly inhibited insulin-driven activity, presumably due to a dominant-negative effect produced by incomplete phosphorylation in this highly modified family of proteins (13, 17, 48). In addition, insulin-driven activity was decreased in MIN6 cells by siRNAs targeted to nucleotides 64-84 or 82-102 of the mouse MafA mRNA (Fig. 4B), which were the siRNAs that most effectively blocked MafA synthesis in transfection assays performed in non-islet 293 cells (Fig. 4C). In contrast, these siRNAs had little or no effect on the ubiquitously active simian virus-40 enhancer, nor did the siRNAs to MafA that only modestly reduced protein levels in 293 cells influence insulin-driven activation (i.e. 955-975 and 1054-1074 in Fig. 4, B and C). Importantly, the level of repression by either dominant-negative-acting MafA or the siRNAs was similar to the dysfunctional MafA element binding site mutant (Fig. 4), consistent with MafA serving a central role in insulin activation.


FIG. 4.


Reducing MafA activity levels causes a dramatic loss in insulin-driven activity in cells. -238 WT LUC (0.25 µg) was transfected into TC-3 and/or MIN6 cells with either MafA135-359 (1 µg) (A) or MafA siRNA expression constructs (64-84, 82-102, 955-975, and 1054-1074)) (1 µg) (B). The impact of these conditions on MafA-mediated activation was compared with a dysfunctional MafA binding site mutant in -238 LUC (-238 C1 mt). The normalized relative activity ± S.E. is the ratio of -238 LUC activity plus effector to the wild type reporter gene alone. *, p versus -238 WT LUC alone. C, Western blot analysis of 293 cells transfected with MafA (0.1 µg) and MafA siRNA (1 µg) expression constructs demonstrated that the 64-84 and 82-102 siRNAs to MafA were effective at reducing MafA protein levels. The endogenous -actin level was used to control for loading.


Unlike BETA2 and PDX-1, the p300 Coactivator Does Not Appear to Mediate MafA Stimulation-The non-DNA binding p300 coactivator and its paralogue CBP is involved in transducing signals between PDX-1, BETA2, and the basal RNA polymerase II apparatus (27, 35, 36). In addition to this bridging function, BETA2 is uniquely modified by the intrinsic acetyltransferase activity of p300/CBP and its associated factor, p300-associated factor resulting in enhanced DNA binding and transcriptional potency (49). To examine if MafA functionally interacts with p300, HeLa cells were cotransfected with expression plasmids producing p300 and either full-length or the N-terminal activation region of MafA fused in-frame to the DNA-binding domain of the Saccharomyces cerevisiae GAL4 transcription factor. The effect of p300 on Gal4:MafA activation was compared with GAL4:BETA2 chimeras containing the coactivator binding domain (i.e. Gal4:BETA2 and Gal4:BETA2 156-355 (36)). Gal4:MafA activity was not affected by p300, whereas the positive GAL4:BETA2 control was stimulated (Fig. 5). Furthermore, MafA-mediated activation was also not impacted by p300 dl10, a mutant coactivator that functions more effectively with BETA2 (36) and PDX-1 (35).


FIG. 5.


p300 does not interact with MafA. The transcriptional activity of the full-length and mutant GAL4:MafA fusion proteins were examined in the presence of p300 in HeLa cells. Control transfections with p300-responsive GAL4:BETA2 chimeras are shown (36). The MafA and BETA2 sequences within the mutant GAL4 chimeras are noted in parentheses. Each transfection contained GAL4:effector (0.25 µg), p300 or p300dll0 (0.25-1 µg), (GAL4)5E1bLUC (0.25 µg), and phRL-TK LUC (2 ng). Activity values ± S.E. are presented as the normalized activity of the GAL4 chimera with or without p300 divided by the GAL4 chimera alone. *, p versus GAL4:effector alone.


To more broadly define if MafA transactivation of insulin was influenced by p300, HeLa cells were cotransfected with -238 WT and MafA in the presence or absence of this coactivator. Activation by MafA was unaffected by p300, although the coactivator enhanced insulin enhancer-driven activity in the presence of MafA, PDX-1, and BETA2 (Fig. 6). However, stimulation by these effectors was essentially reduced to the level of MafA alone by adenovirus E1A (Fig. 6), a factor that inhibits protein-protein-mediated communication between p300/CBP and BETA2 (36) or PDX-1 (35). Collectively, the data strongly suggests that the p300/CBP coactivator does not directly influence MafA activation of the insulin gene in cells.


FIG. 6.


The p300 coactivator does not influence MafA-driven stimulation of the insulin gene. The -238 LUC reporter and expression vectors encoding for MafA (0.25 µg), BETA2 (0.25 µg), PDX-1 (0.25 µg), p300 (0.25 µg), and E1A (0.25 µg) were transfected into HeLa cells, as indicated. Values are expressed as the normalized-fold of effector stimulation ± S.E. relative to -238 LUC + MafA. *, p versus MafA alone.


Insulin Gene Expression Appears to Be Induced in Response to MafA in Islets-The most important regulator of insulin expression in islet cells is glucose, which stimulates insulin gene transcription, protein synthesis, and secretion. Glucose-induced transcription is dependent upon MafA in cell lines, a process mediated by increased DNA-binding factor levels (17). To determine if the MafA in islet cells also regulated glucose-stimulated insulin mRNA expression, isolated rat islets were cultured under simulating (16.7 mM) and non-simulating (2.8 mM) glucose concentrations for 24 h. Endogenous insulin mRNA levels were induced 2.5-fold under these conditions, whereas MafA DNA binding and protein levels were increased even more profoundly (Fig. 7). In contrast, neither the levels of the insulin E1 element activator, which contains the islet-enriched BETA2 protein (16), nor the ubiquitously distributed TATA-binding protein were affected (Fig. 7, A and B).


FIG. 7.


Islet MafA levels were induced in response to stimulating glucose treatment. A, gel shift binding reactions were conducted in the presence of insulin C1 and E1 element probes with nuclear extracts prepared after 24 h from 2.8 and 16.7 mM glucose-treated rat islet samples. As expected, the addition of -Maf antiserum super-shifted the C1 element binding complex in lane 3, whereas in lane 4 the competition with 50-fold excess unlabeled probe eliminated MafA and BETA2:E47 binding to C1 and E1, respectively. Similar results were obtained in two replicate experiments. B, the relative change in MafA and the TATA-binding protein (TBP) was determined by Western analysis in the 2.8 and 16.7 mM glucose-treated rat islet nuclear extracts. The result presented is representative of five independent experiments. C, preproinsulin and -actin mRNA levels were measured by TaqMan reverse transcription-PCR. The results are expressed as the ratio of insulin to -actin mRNA levels, as normalized to the level at 2.8 mM glucose. Results are the average ± S.E. of three replicate experiments. *, p


The results in islets (Fig. 7) and cell lines (29) indicate that insulin mRNA expression increases in parallel with MafA (Fig. 5D). To examine this association in further detail, rat islets were infected with an adenovirus expressing MafA (AdV-MafA) or luciferase (AdV-LUC) and cultured for 72 h in the presence of 16.7 mM glucose. Insulin mRNA levels were increased selectively by 2-fold by AdV-MafA infection relative to -actin control levels (Fig. 8). Collectively, the islet data are not only consistent with MafA being a principal mediator of insulin gene transcription in cell in vivo but also imply that this factor may be limiting to transcription in islets.


FIG. 8.


Endogenous insulin mRNA levels are increased by overexpression of MafA in the rat islets. Isolated rat islets were infected with AdV-MafA or AdV-Luc and then cultured in 16.7 mM glucose for 72 h. Preproinsulin and -actin mRNA levels were measured in the ribonuclease protection assay. A, a representative experiment. B, the average ± S.E. of eight replicate experiments. The data are expressed as preproinsulin to -actin mRNA levels when normalized to Ad-Luc infected control conditions. *, p


DISCUSSION


Expression of the mammalian insulin gene is restricted to pancreatic cells. Release of this hormone from the cell promotes the storage of metabolic fuels and is tightly regulated by nutritional conditions in vivo, with disturbances in production and release contributing to hyperglycemia in various types of diabetes. The mechanisms involved in driving cell-type-specific transcription appear to principally involve the cis-acting elements located within the proximal enhancer region. The activator factors binding to this region are thought to result in the recruitment of the general transcription apparatus to the nearby promoter, providing transcriptional synergy through interactions between activators and components of the basal transcription apparatus. In the present study, MafA was shown to act in conjunction with other known insulin enhancer regulatory factors (BETA2 and PDX-1) to promote synergistic transcription of the insulin gene in non- cell lines. Limiting MafA activity in cell lines was also found to compromise insulin transcription, whereas overexpression elevated steady-state insulin mRNA levels in islets. Together, these results suggest that MafA likely has a profound influence on transcription of the insulin gene in vivo.


The first molecular sign of pancreatic development is the restricted expression of PDX-1, which occurs prior to insulin transcription at embryonic day E8.5 (19, 46). PAX6 (9, 50) and BETA2 (8) are detected around E10, preceding the production of the first insulin-positive cells around E10.5. However, the few insulin-positive cells found at this time lack specific products required for mature islet cell function and are not believed to populate the islet (51, 52). Fully differentiated cells first appear around E13 at the start of a massive wave of cell differentiation termed the "secondary transition" (53). Because MafA is first detected in this insulin-producing cell population, we sought to determine if this factor cooperated with other insulin gene enhancer factors to stimulate transcription.


These studies focused on interactions with BETA2 and PDX-1, which have been shown to act together to mediate insulin activation (35, 54). Here we show that in transfected non- cells, MafA led to significantly higher insulin-driven activity when combined with BETA2 and PDX-1 (Fig. 1). The removal of MafA activity from cell lines also clearly supported the importance of this factor in insulin gene expression (Fig. 4). Thus, insulin reporter gene activity was reduced to a level approaching a dysfunctional MafA binding site mutant upon coexpression of the wild type insulin reporter with either a dominant negative-acting MafA (i.e. MafA135-359) or siRNAs targeted to nucleotides 64-84 or 82-102 of the MafA mRNA. Furthermore, endogenous islet insulin gene expression was shown to be induced in parallel with MafA in response to glucose stimulation or adenoviral mediated overexpression (Figs. 7 and 8). The ability of MafA to induce islet expression under these conditions is consistent with a defining role in controlling insulin transcription unit activity.


Strikingly, MafA is the only islet-enriched transcription factor expressed exclusively in islet cells or in such a restricted fashion during islet cell development (29). Collectively, these observations indicate that MafA is critical for the assembly and function of the insulin gene transcription complex. Although cooperative interactions with this factor likely lead to the high level of specificity in insulin gene activation and to a high level of transcriptional synergy in islet cells, MafA is not absolutely essential for expression. This conclusion is based upon the presence of insulin positive cells during the early stages of pancreatic development, prior to MafA expression (29). Furthermore, MafA is also not found in the few insulin-positive cells present in Nkx6.1 transcription factor null mice (29), which result in a profound and specific reduction in neogenesis of secondary transition -cells (55). These results led to the proposal that MafA acts downstream of Nkx6.1 during a late stage of cell formation. As a consequence, islet insulin expression will likely be severely compromised in MafA knock-out mice, although MafB may provide some level of compensation. Low level insulin gene expression is observed in insulin transcription factor knockdown mice (PAX6 (9), PDX-1 (19), and BETA2 (8)), demonstrating that interactions between a subset of these activator proteins provides some level of transcriptional activation.


The insulin activators not only function to induce localization of the basal transcriptional machinery to the promoter, but also by recruiting chromatin-modifying complexes. Thus, chromatin remodeling and covalent histone modifications are important for the function of transcriptional activators. For example, the acetylation of core histones by p300/CBP and PCAF, which are recruited to the insulin enhancer by PDX-1 and BETA2 (27, 49, 53), is thought to loosen the nucleosome structure and make available new factor binding sites by disrupting higher order chromatin structures (56, 57). It is not yet clear how MafA, PDX-1, and BETA2 function together to facilitate insulin gene transcription, although our results demonstrate that p300/CBP is not involved in MafA-mediated activation (Fig. 5). However, MafA may be involved in recruiting a distinct chromatin-modifying activity such as SWI/SNF, which uses the energy of ATP hydrolysis to alter nucleosome structure and/or facilitate nucleosome mobility (58).

【参考文献】
  Karlsson, O., Edlund, T., Moss, J. B., Rutter, W. J., and Walker, M. D. (1987) Proc. Natl. Acad. Sci. U. S. A. 84, 8819-8823

Shieh, S. Y., and Tsai, M. J. (1991) J. Biol. Chem. 266, 16708-16714

Whelan, J., Poon, D., Weil, P. A., and Stein, R. (1989) Mol. Cell. Biol. 9, 3253-3259

Crowe, D. T., and Tsai, M. J. (1989) Mol. Cell. Biol. 9, 1784-1789

Ohneda, K., Ee, H., and German, M. (2000) Semin. Cell Dev. Biol. 11, 227-233

Melloul, D., Marshak, S., and Cerasi, E. (2002) Diabetologia 45, 309-326

Naya, F. J., Stellrecht, C. M., and Tsai, M. J. (1995) Genes Dev. 9, 1009-1019

Naya, F. J., Huang, H. P., Qiu, Y., Mutoh, H., DeMayo, F. J., Leiter, A. B., and Tsai, M. J. (1997) Genes Dev. 11, 2323-2334

Sander, M., Neubuser, A., Kalamaras, J., Ee, H. C., Martin, G. R., and Ger-man, M. S. (1997) Genes Dev. 11, 1662-1673

Guz, Y., Montminy, M. R., Stein, R., Leonard, J., Gamer, L. W., Wright, C. V., and Teitelman, G. (1995) Development 121, 11-18

Olbrot, M., Rud, J., Moss, L. G., and Sharma, A. (2002) Proc. Natl. Acad. Sci. U. S. A. 99, 6737-6742

Kataoka, K., Han, S. I., Shioda, S., Hirai, M., Nishizawa, M., and Handa, H. (2002) J. Biol. Chem. 277, 49903-49910

Matsuoka, T. A., Zhao, L., Artner, I., Jarrett, H. W., Friedman, D., Means, A., and Stein, R. (2003) Mol. Cell. Biol. 23, 6049-6062

Marshak, S., Totary, H., Cerasi, E., and Melloul, D. (1996) Proc. Natl. Acad. Sci. U. S. A. 93, 15057-15062

Petersen, H. V., Peshavaria, M., Pedersen, A. A., Philippe, J., Stein, R., Madsen, O. D., and Serup, P. (1998) FEBS Lett. 431, 362-366

Sharma, A., and Stein, R. (1994) Mol. Cell. Biol. 14, 871-879

Zhao, L., Cissell, M. A., Henderson, E., Colbran, R., and Stein, R. (2000) J. Biol. Chem. 275, 10532-10537

Jonsson, J., Carlsson, L., Edlund, T., and Edlund, H. (1994) Nature 371, 606-609

Offield, M. F., Jetton, T. L., Labosky, P. A., Ray, M., Stein, R. W., Magnuson, M. A., Hogan, B. L., and Wright, C. V. (1996) Development 122, 983-995

Yasuda, T., Kajimoto, Y., Fujitani, Y., Watada, H., Yamamoto, S., Watarai, T., Umayahara, Y., Matsuhisa, M., Gorogawa, S., Kuwayama, Y., Tano, Y., Yamasaki, Y., and Hori, M. (2002) Diabetes 51, 224-230

Malecki, M. T., Jhala, U. S., Antonellis, A., Fields, L., Doria, A., Orban, T., Saad, M., Warram, J. H., Montminy, M., and Krolewski, A. S. (1999) Nat. Genet. 23, 323-328

Stoffers, D. A., Ferrer, J., Clarke, W. L., and Habener, J. F. (1997) Nat. Genet. 17, 138-139

Moates, J. M., Nanda, S., Cissell, M. A., Tsai, M. J., and Stein, R. (2003) Diabetes 52, 403-408

Watada, H., Kajimoto, Y., Miyagawa, J., Hanafusa, T., Hamaguchi, K., Matsuoka, T., Yamamoto, K., Matsuzawa, Y., Kawamori, R., and Yamasaki, Y. (1996) Diabetes 45, 1826-1831

Waeber, G., Thompson, N., Nicod, P., and Bonny, C. (1996) Mol. Endocrinol. 10, 1327-1334

Serup, P., Jensen, J., Andersen, F. G., Jorgensen, M. C., Blume, N., Holst, J. J., and Madsen, O. D. (1996) Proc. Natl. Acad. Sci. U. S. A. 93, 9015-9020

Chakrabarti, S. K., James, J. C., and Mirmira, R. G. (2002) J. Biol. Chem. 277, 13286-13293

Cissell, M. A., Zhao, L., Sussel, L., Henderson, E., and Stein, R. (2003) J. Biol. Chem. 278, 751-756

Matsuoka, T. A., Artner, I., Henderson, E., Means, A., Sander, M., and Stein, R. (2004) Proc. Natl. Acad. Sci. U. S. A. 101, 2930-2933

Samaras, S. E., Zhao, L., Means, A., Henderson, E., Matsuoka, T. A., and Stein, R. (2003) J. Biol. Chem. 278, 12263-12270

Blanchi, B., Kelly, L. M., Viemari, J. C., Lafon, I., Burnet, H., Bevengut, M., Tillmanns, S., Daniel, L., Graf, T., Hilaire, G., and Sieweke, M. H. (2003) Nat. Neurosci. 6, 1091-1100

Kim, J. I., Li, T., Ho, I. C., Grusby, M. J., and Glimcher, L. H. (1999) Proc. Natl. Acad. Sci. U. S. A. 96, 3781-3785

MacLean, H. E., Kim, J. I., Glimcher, M. J., Wang, J., Kronenberg, H. M., and Glimcher, L. H. (2003) Dev. Biol. 262, 51-63

Mears, A. J., Kondo, M., Swain, P. K., Takada, Y., Bush, R. A., Saunders, T. L., Sieving, P. A., and Swaroop, A. (2001) Nat. Genet. 29, 447-452

Qiu, Y., Guo, M., Huang, S., and Stein, R. (2002) Mol. Cell. Biol. 22, 412-420

Qiu, Y., Sharma, A., and Stein, R. (1998) Mol. Cell. Biol. 18, 2957-2964

Peshavaria, M., Gamer, L., Henderson, E., Teitelman, G., Wright, C. V., and Stein, R. (1994) Mol. Endocrinol. 8, 806-816

Robinson, G. L., Peshavaria, M., Henderson, E., Shieh, S. Y., Tsai, M. J., Teitelman, G., and Stein, R. (1994) J. Biol. Chem. 269, 2452-2460

Peshavaria, M., Henderson, E., Sharma, A., Wright, C. V., and Stein, R. (1997) Mol. Cell. Biol. 17, 3987-3996

Lillie, J. W., and Green, M. R. (1989) Nature 338, 39-44

Lee, J. S., Galvin, K. M., See, R. H., Eckner, R., Livingston, D., Moran, E., and Shi, Y. (1995) Genes Dev. 9, 1188-1198

Kelpe, C. L., Moore, P. C., Parazzoli, S. D., Wicksteed, B., Rhodes, C. J., and Poitout, V. (2003) J. Biol. Chem. 278, 30015-30021

Brummelkamp, T. R., Bernards, R., and Agami, R. (2002) Science 296, 550-553

Briaud, I., Harmon, J. S., Kelpe, C. L., Segu, V. B., and Poitout, V. (2001) Diabetes 50, 315-321

Wicksteed, B., Herbert, T. P., Alarcon, C., Lingohr, M. K., Moss, L. G., and Rhodes, C. J. (2001) J. Biol. Chem. 276, 22553-22558

Ahlgren, U., Jonsson, J., and Edlund, H. (1996) Development 122, 1409-1416

Nishizawa, M., Kataoka, K., and Vogt, P. K. (2003) Oncogene 22, 7882-7890

Benkhelifa, S., Provot, S., Nabais, E., Eychene, A., Calothy, G., and Felder-Schmittbuhl, M. P. (2001) Mol. Cell. Biol. 21, 4441-4452

Qiu, Y., Guo, M., Huang, S., and Stein, R. (2004) J. Biol. Chem. 279, 9796-9802

St-Onge, L., Sosa-Pineda, B., Chowdhury, K., Mansouri, A., and Gruss, P. (1997) Nature 387, 406-409

Oster, A., Jensen, J., Serup, P., Galante, P., Madsen, O. D., and Larsson, L. I. (1998) J. Histochem. Cytochem. 46, 707-715

Pang, K., Mukonoweshuro, C., and Wong, G. G. (1994) Proc. Natl. Acad. Sci. U. S. A. 91, 9559-9563

Pictet, R., and Rutter, W. J. (1972) Handbook of Physiology (Steiner, D. F., and Frenkel, N., eds) pp. 25-66, Williams and Wilkins, Baltimore, MD

Glick, E., Leshkowitz, D., and Walker, M. D. (2000) J. Biol. Chem. 275, 2199-2204

Sander, M., Sussel, L., Conners, J., Scheel, D., Kalamaras, J., Dela Cruz, F., Schwitzgebel, V., Hayes-Jordan, A., and German, M. (2000) Development 127, 5533-5540

Mizzen, C. A., and Allis, C. D. (1998) Cell Mol. Life Sci. 54, 6-20

Grunstein, M. (1997) Nature 389, 349-352

Kingston, R. E., and Narlikar, G. J. (1999) Genes Dev. 13, 2339-2352

  订阅登记:

请您在下面输入常用的Email地址、职业以便我们定期通过邮箱发送给您最新的相关医学信息,感谢您浏览首席医学网!

邮箱:    职业: